Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Gal1/10 Ura S. cerevisiae expression vector (12URA-U) Resource Report Resource Website |
RRID:Addgene_48306 | Ampicillin | Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector can complement Ura auxotrophy. Add the following tags to your PCR primers: Note: You must add an ATG to the beginning of your open reading frame. LICvBac Forward Tag TACTTCCAATCCAATCG LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-). For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:8878; Vector Backbone:pRS426; Vector Types:NA; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:49 | 0 | ||||
|
pJH104 Resource Report Resource Website |
RRID:Addgene_48262 | TEF1p 5' fragment | Saccharomyces cerevisiae | Ampicillin | PMID:24604451 | Created by 4-part ligation with XhoI/EagI cut pBluescript II SK (-). Inserts were XhoI/XbaI TEF1p, XbaI/BamHI URA3, and BamHI/EagI TEF1p. | Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin | From SK1 background. -460 to -128 relative to TEF1 ORF | 2026-08-15 01:15:48 | 0 |
|
Gal1/10 Ade S. cerevisiae expression vector (12ADE-U) Resource Report Resource Website |
RRID:Addgene_48300 | Ampicillin | Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector can complement Ade auxotrophy. Add the following tags to your PCR primers: Note: You must add an ATG to the beginning of your open reading frame. LICvBac Forward Tag TACTTCCAATCCAATCG LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-). For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:8429; Vector Backbone:pRS422; Vector Types:NA; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:49 | 0 | ||||
|
pJH124 Resource Report Resource Website |
RRID:Addgene_48259 | URA3 3' fragment | Saccharomyces cerevisiae | Ampicillin | PMID:24604451 | pJH124 was created by cloning an XbaI/XhoI Ag TEF1 promoter fragment into the same sites of vector IpO. The cloned insert was confirmed by DNA sequencing. | Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin | URA3 ORF from +216 to 80 bp downstream of the stop codon | 2026-08-15 01:15:49 | 0 |
|
PXNGW Resource Report Resource Website |
RRID:Addgene_48258 | Chloramphenicol and Spectinomycin | PMID:19366901 | Vector Backbone:pRT100/pPZP312; Vector Types:Binary Gateway vector; Bacterial Resistance:Chloramphenicol and Spectinomycin | 2026-08-15 01:15:48 | 0 | ||||
|
pC1-HyPer-Red-C199S Resource Report Resource Website 1+ mentions |
RRID:Addgene_48252 | HYPER-RED-C199S | Synthetic | Kanamycin | PMID:25330925 | Backbone Size:3975; Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:48 | 3 | ||
|
pAC154-dual-dCas9VP160-sgExpression Resource Report Resource Website 10+ mentions |
RRID:Addgene_48240 | dCas9 | Synthetic | Ampicillin | PMID:23979020 | Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT For more information including protocols and updates, please go to http://www.crispr-on.org | Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | D10A H840A | 2026-08-15 01:15:48 | 24 |
|
pET29b-ClbP Resource Report Resource Website 1+ mentions |
RRID:Addgene_48244 | ClbP | Escherichia coli CFT073 | Kanamycin | PMID:23406518 | Backbone Marker:Novagen; Backbone Size:5370; Vector Backbone:pET29b-(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:48 | 2 | ||
|
pET29b-ClbPpep-CHis Resource Report Resource Website |
RRID:Addgene_48243 | ClbP-pep | Escherichia coli CFT073 | Kanamycin | PMID:23406518 | Backbone Marker:Novagen; Backbone Size:5370; Vector Backbone:pET29b-(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | First 375 amino acids of the peptidase, which contains the soluble periplasmic peptidase domain | 2026-08-15 01:15:48 | 0 | |
|
pHJ42 Resource Report Resource Website |
RRID:Addgene_48359 | Partial beta-TUB followed by 5' ALD UTR-loxP-SAS-BLE-Ty1-TK-loxP-3' ALD UTR | T. brucei | Ampicillin | PMID:23954366 | For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html There are several mismatches between Addgene's quality control sequence and the reference sequence from the depositing lab; most notably in the beta-tubulin ORF, HSV thymidine kinase and the T. brucei Aldolase 3'UTR. These mismatches should not affect plasmid function. | Backbone Marker:Cross Lab; Vector Backbone:pHD309; Vector Types:Cre/Lox, Knockout in T. Brucei; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:49 | 0 | |
|
pDONR P2R-P3-ECFP Resource Report Resource Website |
RRID:Addgene_48353 | ECFP | Synthetic | Kanamycin | PMID:23957834 | Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2651; Vector Backbone:pDONRP2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Contains a stop codon. | 2026-08-15 01:15:49 | 0 | |
|
pFUSB4_CATG Resource Report Resource Website |
RRID:Addgene_48446 | RVD sequence: HD NI NG NN | Synthetic | Spectinomycin | PMID:23734242 | Plasmid was created using Golden Gate cloning. | Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:50 | 0 | |
|
pFUSB4_CATA Resource Report Resource Website |
RRID:Addgene_48444 | RVD sequence: HD NI NG NI | Synthetic | Spectinomycin | PMID:23734242 | Plasmid was created using Golden Gate cloning. | Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:50 | 0 | |
|
pFUSB4_CCAC Resource Report Resource Website |
RRID:Addgene_48449 | RVD sequence: HD HD NI HD | Synthetic | Spectinomycin | PMID:23734242 | Plasmid was created using Golden Gate cloning. | Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:50 | 0 | |
|
pFUSB4_CCAA Resource Report Resource Website |
RRID:Addgene_48448 | RVD sequence: HD HD NI NI | Synthetic | Spectinomycin | PMID:23734242 | Plasmid was created using Golden Gate cloning. | Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:50 | 0 | |
|
pFUSB4_CAGT Resource Report Resource Website |
RRID:Addgene_48443 | RVD sequence: HD NI NN NG | Synthetic | Spectinomycin | PMID:23734242 | Plasmid was created using Golden Gate cloning. | Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:50 | 0 | |
|
pFUSB4_CAGG Resource Report Resource Website |
RRID:Addgene_48442 | RVD sequence: HD NI NN NN | Synthetic | Spectinomycin | PMID:23734242 | Plasmid was created using Golden Gate cloning. | Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:50 | 0 | |
|
pFUSB4_CAGA Resource Report Resource Website |
RRID:Addgene_48440 | RVD sequence: HD NI NN NI | Synthetic | Spectinomycin | PMID:23734242 | Plasmid was created using Golden Gate cloning. | Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:50 | 0 | |
|
pFUSB4_CACA Resource Report Resource Website |
RRID:Addgene_48436 | RVD sequence: HD NI HD NI | Synthetic | Spectinomycin | PMID:23734242 | Plasmid was created using Golden Gate cloning. | Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:50 | 0 | |
|
pFUSB4_CAAT Resource Report Resource Website |
RRID:Addgene_48435 | RVD sequence: HD NI NI NG | Synthetic | Spectinomycin | PMID:23734242 | Plasmid was created using Golden Gate cloning. | Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:50 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
