Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: FOXP3
Vector Backbone Description: Backbone Size:0; Vector Backbone:pRV.GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16873067
Comments: pRV GFP has IRES, EGFP, MMLV LTR.
Proper citation: RRID:Addgene_13250 Copy
Species: Homo sapiens
Genetic Insert: NEFL
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4001; Vector Backbone:pEGFP-C1 with EGFP sequence removed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31574566
Proper citation: RRID:Addgene_132589 Copy
Species: Homo sapiens
Genetic Insert: RNF146
Vector Backbone Description: Vector Backbone:pGEX-6P2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25327252
Proper citation: RRID:Addgene_132610 Copy
Species: Homo sapiens
Genetic Insert: INA
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3981; Vector Backbone:pEGFP-C1 with EGFP sequence removed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31574566
Proper citation: RRID:Addgene_132606 Copy
Species: Arabidopsis thaliana
Genetic Insert: egg cell promoter, Cas9-mApple, pds3 sgRNA
Vector Backbone Description: Backbone Marker:https://gateway.psb.ugent.be; Backbone Size:8820; Vector Backbone:pH2GW7; Vector Types:Plant Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32096870
Comments: Egg cell promoters amplified directly from A. thaliana leaf tissue based on the promoters in Addgene plasmid #71288, described in doi: 10.1186/s13059-015-0715-0 Please visit https://www.biorxiv.org/content/10.1101/852020v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_132568 Copy
Species: Homo sapiens
Genetic Insert: human miR-302 cluster: MIR302B, MIR302C, MIR302A, MIR302D, MIR367
Vector Backbone Description: Backbone Marker:Broad Insitute; Backbone Size:8405; Vector Backbone:pCW57-GFP-2A-MCS; Vector Types:Mammalian Expression, Lentiviral, Doxycycline inducible, microRNA expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31673026
Comments: MIR302 cluster was PCR-amplified from genomic DNA using the following primers: Fwd - ACACCGGTGAAGTTGTATGTTGGGTGGGCT; Rev - CGTGTACACGTTATTTAACAATCCATCACCATTGCTAAAGT and cloned into pJET. pJET was digested using AgeI/BsrGI and inserted into AgeI/BsrGI digested pCW57-GFP-MCS vector (Addgene #71783).
Proper citation: RRID:Addgene_132549 Copy
Species: Caenorhabditis elegans
Genetic Insert: mNG-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:3881; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26044593
Proper citation: RRID:Addgene_132523 Copy
Species: Rattus norvegicus
Genetic Insert: eUNG-BE4max(R33A)-ΔUGI
Vector Backbone Description: Backbone Marker:pCMV-ABEmax-P2A-EGFP (Addgene #112101); Backbone Size:3400; Vector Backbone:CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32690971
Proper citation: RRID:Addgene_140252 Copy
Species: Homo sapiens
Genetic Insert: eGFP-2A-Tau
Vector Backbone Description: Backbone Size:6468; Vector Backbone:AAV.CBA.WPRE; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31249873
Comments: Please Note: Plasmid contains a 152bp deletion in the backbone that removes the first 84bp of the ITR upstream of the CAG promoter. This deletion is not known to affect plasmid function. Plasmid 240284 (https://www.addgene.org/240284/) is an alternative version with a complete ITR.
Proper citation: RRID:Addgene_140424 Copy
Species: Homo sapiens
Genetic Insert: 5-HT sensor GRAB_5-HT1.0
Vector Backbone Description: Backbone Size:4495; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33821000
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.02.24.962282v1 for BioRxiv preprint.
Proper citation: RRID:Addgene_140552 Copy
Species: Other
Genetic Insert: T7-lacO-TtgR-T
Vector Backbone Description: Vector Backbone:pET28c; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32632301
Proper citation: RRID:Addgene_140391 Copy
Species: Streptococcus pyogenes
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:pX165; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32187529
Proper citation: RRID:Addgene_140563 Copy
Species: Homo sapiens
Genetic Insert: TGIF
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10601270
Comments: See article and author's map for more information.
Proper citation: RRID:Addgene_14047 Copy
Species: Streptococcus pyogenes
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:pX165; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32187529
Proper citation: RRID:Addgene_140560 Copy
Species: Streptococcus pyogenes
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:pX165; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32187529
Proper citation: RRID:Addgene_140561 Copy
Species: Homo sapiens
Genetic Insert: Smad1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8637600
Comments: See author's map for more information.
Proper citation: RRID:Addgene_14045 Copy
Species: Homo sapiens
Genetic Insert: Smad1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8637600
Comments: See author's map for more information.
Proper citation: RRID:Addgene_14044 Copy
Species: Homo sapiens
Genetic Insert: Smad2
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:xenopus/mammalian/avian/zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9214507
Comments: See author's map for more information.
Proper citation: RRID:Addgene_14042 Copy
Genetic Insert: dnaQ926 dam seqA emrR ugi CDA1 gIII
Vector Backbone Description: Backbone Size:2992; Vector Backbone:CloDF13; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:26443021
Comments: Please note that Addgene's NGS found a 65bp insertion in the ori region as compared to the Depositor's sequence. The effect of this insertion is unknown.
Proper citation: RRID:Addgene_140446 Copy
Species: Homo sapiens
Genetic Insert: Smad3
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:xenopus/mammalian/avian/zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10197981
Proper citation: RRID:Addgene_14052 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
