Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pRV.GFP FOXP3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_13250 FOXP3 Homo sapiens Ampicillin PMID:16873067 pRV GFP has IRES, EGFP, MMLV LTR. Backbone Size:0; Vector Backbone:pRV.GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:05:28 2
phNFL
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_132589 NEFL Homo sapiens Kanamycin PMID:31574566 Backbone Marker:Clontech; Backbone Size:4001; Vector Backbone:pEGFP-C1 with EGFP sequence removed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:05:29 2
pGEX6P-2-human RNF146 full length
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_132610 RNF146 Homo sapiens Ampicillin PMID:25327252 Vector Backbone:pGEX-6P2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:05:30 1
phINA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_132606 INA Homo sapiens Kanamycin PMID:31574566 Backbone Marker:Clontech; Backbone Size:3981; Vector Backbone:pEGFP-C1 with EGFP sequence removed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:05:29 1
GS2.1/EC
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_132568 egg cell promoter, Cas9-mApple, pds3 sgRNA Arabidopsis thaliana Spectinomycin PMID:32096870 Egg cell promoters amplified directly from A. thaliana leaf tissue based on the promoters in Addgene plasmid #71288, described in doi: 10.1186/s13059-015-0715-0 Please visit https://www.biorxiv.org/content/10.1101/852020v1 for bioRxiv preprint. Backbone Marker:https://gateway.psb.ugent.be; Backbone Size:8820; Vector Backbone:pH2GW7; Vector Types:Plant Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-15 01:05:29 1
pCW57-GFP-miR-302cluster
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_132549 human miR-302 cluster: MIR302B, MIR302C, MIR302A, MIR302D, MIR367 Homo sapiens Ampicillin PMID:31673026 MIR302 cluster was PCR-amplified from genomic DNA using the following primers: Fwd - ACACCGGTGAAGTTGTATGTTGGGTGGGCT; Rev - CGTGTACACGTTATTTAACAATCCATCACCATTGCTAAAGT and cloned into pJET. pJET was digested using AgeI/BsrGI and inserted into AgeI/BsrGI digested pCW57-GFP-MCS vector (Addgene #71783). Backbone Marker:Broad Insitute; Backbone Size:8405; Vector Backbone:pCW57-GFP-2A-MCS; Vector Types:Mammalian Expression, Lentiviral, Doxycycline inducible, microRNA expression; Bacterial Resistance:Ampicillin 2026-08-15 01:05:29 1
pDD268
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_132523 mNG-C1^SEC^3xFlag Caenorhabditis elegans Ampicillin PMID:26044593 Backbone Size:3881; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:05:29 7
CGBE1 (pRZ3885)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_140252 eUNG-BE4max(R33A)-ΔUGI Rattus norvegicus Ampicillin PMID:32690971 Backbone Marker:pCMV-ABEmax-P2A-EGFP (Addgene #112101); Backbone Size:3400; Vector Backbone:CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R33A in rAPOBEC1, D10A in Cas9 2026-08-15 01:06:40 1
AAV.CBA.eGFP.2A.wtTau
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_140424 eGFP-2A-Tau Homo sapiens Ampicillin PMID:31249873 Please Note: Plasmid contains a 152bp deletion in the backbone that removes the first 84bp of the ITR upstream of the CAG promoter. This deletion is not known to affect plasmid function. Plasmid 240284 (https://www.addgene.org/240284/) is an alternative version with a complete ITR. Backbone Size:6468; Vector Backbone:AAV.CBA.WPRE; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:06:41 1
pAAV-hsyn-GRAB_5-HT1.0
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_140552 5-HT sensor GRAB_5-HT1.0 Homo sapiens Ampicillin PMID:33821000 Please visit https://www.biorxiv.org/content/10.1101/2020.02.24.962282v1 for BioRxiv preprint. Backbone Size:4495; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:06:42 3
pJBL721
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_140391 T7-lacO-TtgR-T Other Kanamycin PMID:32632301 Vector Backbone:pET28c; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:06:41 1
pX165-HiFi Cas9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_140563 Cas9 Streptococcus pyogenes Ampicillin PMID:32187529 Vector Backbone:pX165; Vector Types:; Bacterial Resistance:Ampicillin R691A 2026-08-15 01:06:42 2
pCMV5 Flag TGIF
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_14047 TGIF Homo sapiens Ampicillin PMID:10601270 See article and author's map for more information. Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:06:41 2
pX165-Sniper-Cas9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_140560 Cas9 Streptococcus pyogenes Ampicillin PMID:32187529 Vector Backbone:pX165; Vector Types:; Bacterial Resistance:Ampicillin F539S M763I K890N 2026-08-15 01:06:42 1
pX165-LZ3 Cas9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_140561 Cas9 Streptococcus pyogenes Ampicillin PMID:32187529 Vector Backbone:pX165; Vector Types:; Bacterial Resistance:Ampicillin N690C T769I G915M N980K 2026-08-15 01:06:42 3
pCMV5 Smad1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_14045 Smad1 Homo sapiens Ampicillin PMID:8637600 See author's map for more information. Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:06:41 1
pCMV5 Flag-Smad1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_14044 Smad1 Homo sapiens Ampicillin PMID:8637600 See author's map for more information. Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:06:41 3
CS2 Flag-Smad2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_14042 Smad2 Homo sapiens Ampicillin PMID:9214507 See author's map for more information. Backbone Size:4100; Vector Backbone:pCS2; Vector Types:xenopus/mammalian/avian/zebrafish; Bacterial Resistance:Ampicillin 2026-08-15 01:06:41 7
DP6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_140446 dnaQ926 dam seqA emrR ugi CDA1 gIII Chloramphenicol PMID:26443021 Please note that Addgene's NGS found a 65bp insertion in the ori region as compared to the Depositor's sequence. The effect of this insertion is unknown. Backbone Size:2992; Vector Backbone:CloDF13; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:06:41 2
CS2 Flag-Smad3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_14052 Smad3 Homo sapiens Ampicillin PMID:10197981 Backbone Size:4100; Vector Backbone:pCS2; Vector Types:xenopus/mammalian/avian/zebrafish; Bacterial Resistance:Ampicillin 2026-08-15 01:06:41 9

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch