Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: iGABASnFR.R205A
Vector Backbone Description: Vector Backbone:pDisplay; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31308547
Comments: Please visit https://www.biorxiv.org/content/early/2018/05/14/322578 for bioRxiv preprint.
Proper citation: RRID:Addgene_112178 Copy
Species: Other
Genetic Insert: iGABASnFR.F102G
Vector Backbone Description: Vector Backbone:pDisplay; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31308547
Comments: Please visit https://www.biorxiv.org/content/early/2018/05/14/322578 for bioRxiv preprint.
Proper citation: RRID:Addgene_112180 Copy
Species: Other
Genetic Insert: tdT
Vector Backbone Description: Backbone Size:8900; Vector Backbone:pZ P CAGGS tdTPH (AddGene plasmid 112668); Vector Types:Mammalian Expression, AAV, Donor plasmid for recombinase-mediated cassette exchange; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26455413
Proper citation: RRID:Addgene_112669 Copy
Species: Other
Genetic Insert: eGFP
Vector Backbone Description: Backbone Size:4570; Vector Backbone:pZ donor AAVS1 vector (CompoZr Targeted Integration Kit, Sigma Aldrich); Vector Types:Mammalian Expression, Gene targeting vector for integration at the S1 site; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26455413
Proper citation: RRID:Addgene_112666 Copy
Species: Other
Genetic Insert: EGFP-Synaptobrevin-2; tdTomato
Vector Backbone Description: Backbone Size:4561; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Comments: Sequencing may be difficult due to secondary structure/dimerization. The following primers have been used in the Xu lab:
5': actcagcgctgcctcagtc (upstream of tdTomato)
3': ggccatgttgttgtcctcggaggaggcggtgc (in tdTomato)
5': gggcatggcaccggcagcaccggcagcggcagc (in tdTomato)
3': gctgaacttgtggccgtttacgtcg (in EGFP)
3': cagggtcagcttgccgtaggtggcatcg (in EGFP)
Proper citation: RRID:Addgene_175275 Copy
Species: Other
Genetic Insert: mCherry with microtuble-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740
Proper citation: RRID:Addgene_175829 Copy
Species: Other
Genetic Insert: SECFP with microtuble-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740
Proper citation: RRID:Addgene_175826 Copy
Species: Other
Genetic Insert: EGFP with plasma membrane-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740
Proper citation: RRID:Addgene_175833 Copy
Species: Other
Genetic Insert: Venus with plasma membrane-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740
Proper citation: RRID:Addgene_175834 Copy
Species: Other
Genetic Insert: iRFP with plasma membrane-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740
Proper citation: RRID:Addgene_175836 Copy
Species: Other
Genetic Insert: Sirius with nucleus-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740
Proper citation: RRID:Addgene_175837 Copy
Species: Other
Genetic Insert: SECFP with nucleus-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740
Proper citation: RRID:Addgene_175838 Copy
Species: Other
Genetic Insert: Venus with nucleus-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740
Proper citation: RRID:Addgene_175840 Copy
Species: Other
Genetic Insert: EGFP with nucleus-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740
Proper citation: RRID:Addgene_175839 Copy
Species: Other
Genetic Insert: GFP
Vector Backbone Description: Backbone Size:5050; Vector Backbone:pAAV-CBA-w; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32184391
Proper citation: RRID:Addgene_176215 Copy
Species: Other
Genetic Insert: 4x SV40 polyA
Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBluescript II SK(-); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_176506 Copy
Species: Other
Genetic Insert: FAD-linked sulfhydryl oxidase ERV2 from Fol
Vector Backbone Description: Backbone Size:5068; Vector Backbone:pACYC184-TU2A-RFP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.31.458447v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_176404 Copy
Species: Other
Genetic Insert: HaloTag
Vector Backbone Description: Vector Backbone:pIRES_neo3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33852913
Proper citation: RRID:Addgene_166907 Copy
Species: Other
Genetic Insert: Blasticidin S deaminase
Vector Backbone Description: Backbone Size:14873; Vector Backbone:lentiCRISPR v2 (Addgene #52961); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34524848
Proper citation: RRID:Addgene_167186 Copy
Species: Other
Genetic Insert: GFP-GUS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8000; Vector Backbone:pB7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:28784835
Proper citation: RRID:Addgene_167122 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.