Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 29 showing 561 ~ 580 out of 6,853 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/112178

Species: Other
Genetic Insert: iGABASnFR.R205A
Vector Backbone Description: Vector Backbone:pDisplay; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31308547
Comments: Please visit https://www.biorxiv.org/content/early/2018/05/14/322578 for bioRxiv preprint.

Proper citation: RRID:Addgene_112178 Copy   


http://www.addgene.org/112180

Species: Other
Genetic Insert: iGABASnFR.F102G
Vector Backbone Description: Vector Backbone:pDisplay; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31308547
Comments: Please visit https://www.biorxiv.org/content/early/2018/05/14/322578 for bioRxiv preprint.

Proper citation: RRID:Addgene_112180 Copy   


http://www.addgene.org/112669

Species: Other
Genetic Insert: tdT
Vector Backbone Description: Backbone Size:8900; Vector Backbone:pZ P CAGGS tdTPH (AddGene plasmid 112668); Vector Types:Mammalian Expression, AAV, Donor plasmid for recombinase-mediated cassette exchange; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26455413

Proper citation: RRID:Addgene_112669 Copy   


  • RRID:Addgene_112666

    This resource has 1+ mentions.

http://www.addgene.org/112666

Species: Other
Genetic Insert: eGFP
Vector Backbone Description: Backbone Size:4570; Vector Backbone:pZ donor AAVS1 vector (CompoZr Targeted Integration Kit, Sigma Aldrich); Vector Types:Mammalian Expression, Gene targeting vector for integration at the S1 site; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26455413

Proper citation: RRID:Addgene_112666 Copy   


  • RRID:Addgene_175275

    This resource has 1+ mentions.

http://www.addgene.org/175275

Species: Other
Genetic Insert: EGFP-Synaptobrevin-2; tdTomato
Vector Backbone Description: Backbone Size:4561; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Comments: Sequencing may be difficult due to secondary structure/dimerization. The following primers have been used in the Xu lab: 5': actcagcgctgcctcagtc (upstream of tdTomato) 3': ggccatgttgttgtcctcggaggaggcggtgc (in tdTomato) 5': gggcatggcaccggcagcaccggcagcggcagc (in tdTomato) 3': gctgaacttgtggccgtttacgtcg (in EGFP) 3': cagggtcagcttgccgtaggtggcatcg (in EGFP)

Proper citation: RRID:Addgene_175275 Copy   


  • RRID:Addgene_175829

    This resource has 1+ mentions.

http://www.addgene.org/175829

Species: Other
Genetic Insert: mCherry with microtuble-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740

Proper citation: RRID:Addgene_175829 Copy   


  • RRID:Addgene_175826

http://www.addgene.org/175826

Species: Other
Genetic Insert: SECFP with microtuble-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740

Proper citation: RRID:Addgene_175826 Copy   


  • RRID:Addgene_175833

http://www.addgene.org/175833

Species: Other
Genetic Insert: EGFP with plasma membrane-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740

Proper citation: RRID:Addgene_175833 Copy   


  • RRID:Addgene_175834

http://www.addgene.org/175834

Species: Other
Genetic Insert: Venus with plasma membrane-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740

Proper citation: RRID:Addgene_175834 Copy   


  • RRID:Addgene_175836

http://www.addgene.org/175836

Species: Other
Genetic Insert: iRFP with plasma membrane-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740

Proper citation: RRID:Addgene_175836 Copy   


  • RRID:Addgene_175837

http://www.addgene.org/175837

Species: Other
Genetic Insert: Sirius with nucleus-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740

Proper citation: RRID:Addgene_175837 Copy   


  • RRID:Addgene_175838

http://www.addgene.org/175838

Species: Other
Genetic Insert: SECFP with nucleus-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740

Proper citation: RRID:Addgene_175838 Copy   


  • RRID:Addgene_175840

http://www.addgene.org/175840

Species: Other
Genetic Insert: Venus with nucleus-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740

Proper citation: RRID:Addgene_175840 Copy   


  • RRID:Addgene_175839

http://www.addgene.org/175839

Species: Other
Genetic Insert: EGFP with nucleus-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740

Proper citation: RRID:Addgene_175839 Copy   


  • RRID:Addgene_176215

    This resource has 1+ mentions.

http://www.addgene.org/176215

Species: Other
Genetic Insert: GFP
Vector Backbone Description: Backbone Size:5050; Vector Backbone:pAAV-CBA-w; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32184391

Proper citation: RRID:Addgene_176215 Copy   


  • RRID:Addgene_176506

http://www.addgene.org/176506

Species: Other
Genetic Insert: 4x SV40 polyA
Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBluescript II SK(-); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_176506 Copy   


  • RRID:Addgene_176404

http://www.addgene.org/176404

Species: Other
Genetic Insert: FAD-linked sulfhydryl oxidase ERV2 from Fol
Vector Backbone Description: Backbone Size:5068; Vector Backbone:pACYC184-TU2A-RFP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.31.458447v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_176404 Copy   


  • RRID:Addgene_166907

http://www.addgene.org/166907

Species: Other
Genetic Insert: HaloTag
Vector Backbone Description: Vector Backbone:pIRES_neo3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33852913

Proper citation: RRID:Addgene_166907 Copy   


  • RRID:Addgene_167186

    This resource has 1+ mentions.

http://www.addgene.org/167186

Species: Other
Genetic Insert: Blasticidin S deaminase
Vector Backbone Description: Backbone Size:14873; Vector Backbone:lentiCRISPR v2 (Addgene #52961); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34524848

Proper citation: RRID:Addgene_167186 Copy   


  • RRID:Addgene_167122

    This resource has 1+ mentions.

http://www.addgene.org/167122

Species: Other
Genetic Insert: GFP-GUS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8000; Vector Backbone:pB7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:28784835

Proper citation: RRID:Addgene_167122 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X