Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Vector Backbone:pMMB66EH; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:23416993
Comments: The ampicillin resistance gene of the pMMPc vector (Addgene plasmid # 116920) was replaced with the gentamicin resistance gene from the vector pUC18-mini-Tn7T-Gm.
Proper citation: RRID:Addgene_116921 Copy
Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4316; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven Luciferase miR-shRNA
Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCCACAGATGTATTAATCAGAGACTTCAGGCGGT
Proper citation: RRID:Addgene_25756 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven G alpha 13 miR-shRNA
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
Proper citation: RRID:Addgene_25758 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5180; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT
Proper citation: RRID:Addgene_25754 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5153; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT
Proper citation: RRID:Addgene_25753 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5309; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE
Proper citation: RRID:Addgene_25750 Copy
Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G beta 2 miR-shRNA (TGCTCATGTATTCCCACGACAA) and co-expressed GFP
Proper citation: RRID:Addgene_25766 Copy
Species: Mus musculus
Genetic Insert: G alpha 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G alpha 12 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
Addgene sequence shows that this plasmid is missing the EcoRI and SpeI sites.
Proper citation: RRID:Addgene_25761 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4608; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; Human U6 promoter; 27nt U6 leader sequence expressed in transcript; Entry vector backbone; +ccdB in parent;
Addgene sequence shows that there is a T missing in U6 promoter sequence. Depositor is aware of the mismatch and it should not affect plasmid function.
Proper citation: RRID:Addgene_25747 Copy
Vector Backbone Description: Backbone Size:4546; Vector Backbone:pBAMD1-6; Vector Types:Synthetic Biology, Mini-Tn5 vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:25389526
Proper citation: RRID:Addgene_61566 Copy
Vector Backbone Description: Vector Backbone:pUC18T-miniTn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:15908923
Proper citation: RRID:Addgene_63120 Copy
Species: Homo sapiens
Genetic Insert: GATA binding protein 6
Vector Backbone Description: Backbone Marker:Addgene#25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRC2; Vector Types:Bacterial Expression, Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:27273097
Proper citation: RRID:Addgene_72612 Copy
Species: Homo sapiens
Genetic Insert: GATA binding protein 6
Vector Backbone Description: Backbone Marker:Addgene#25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRC2; Vector Types:Bacterial Expression, Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:27273097
Proper citation: RRID:Addgene_72613 Copy
Species: Homo sapiens
Genetic Insert: GATA Binding Protein 6
Vector Backbone Description: Backbone Marker:Addgene#25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRC2; Vector Types:Bacterial Expression, Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:27273097
Proper citation: RRID:Addgene_72924 Copy
Genetic Insert: lux operon
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:15908923
Comments: GenBank Accession # AY962893
Compared to the Genbank reference sequence AY962893, Addgene's sequencing results found a A85R mutation in luxB. The effect of this difference is unknown. Note that Addgene has not sequenced the entire luxCDABE fusion.
Proper citation: RRID:Addgene_64963 Copy
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:15908923
Comments: Genbank Accession # AY599234
Proper citation: RRID:Addgene_64965 Copy
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:17406227
Comments: GenBank Accession # DQ296494
Compared to the Genbank reference sequence DQ296494, Addgene's sequencing results found T920I, D999E and F1000L mutations in lacZ. The effect of these differences is unknown. Note that the amino acid numbering is relative to the lacZ encoded by this plasmid.
Proper citation: RRID:Addgene_65026 Copy
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:17406227
Comments: GenBank Accession # DQ296495
Compared to the Genbank reference sequence DQ296495, Addgene's sequencing results found T920I, D999E and F1000L mutations in lacZ. The effect of these differences is unknown. Note that the amino acid numbering is relative to the lacZ encoded by this plasmid.
Proper citation: RRID:Addgene_65027 Copy
Genetic Insert: eyfp
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18T-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:17406227
Comments: GenBank Accession # DQ493879
Proper citation: RRID:Addgene_65031 Copy
Genetic Insert: dsRedExpress
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18T-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:17406227
Comments: GenBank Accession # DQ493880
Proper citation: RRID:Addgene_65032 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
