Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: cytokine induced apoptosis inhibitor 1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15998469
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_34811 Copy
Species: Caenorhabditis elegans
Genetic Insert: Peft-3 GFP H2B tbb-2 UTR
Vector Backbone Description: Vector Backbone:pDESTR4-R3; Vector Types:Worm targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22290181
Comments: We would like to thank Andrew Wood and Barbara Meyer for sending us the Peft-3 promoter and pointing out how strong the promoter is.
Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_34877 Copy
Species: Caenorhabditis elegans
Genetic Insert: Mos1 transpoase
Vector Backbone Description: Vector Backbone:pDESTR4-R3; Vector Types:Worm targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22290181
Comments: Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_34874 Copy
Species: Mus musculus
Genetic Insert: postsynaptic mGRASP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:paavCAG; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22138823
Proper citation: RRID:Addgene_34913 Copy
Genetic Insert: SB100X transposase
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:19412179
Comments: The Sleeping Beauty transposon system consists of two components: the transposon vector and the transposase vector. The transposon vector (pT4/HB, Addgene #108352) contains binding sites flanking the GOI. And the transposase vector (pCMV(CAT)T7-SB100, Addgene #34879) encodes for the enzyme mediating excision and integration of the GOI.
Proper citation: RRID:Addgene_34879 Copy
Vector Backbone Description: Vector Backbone:pBCN21-R4R3; Vector Types:Worm Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22290182
Comments: Dual resistance (PuroR-NeoR) vector for drug selection following biolistic bombardment in worms.
This vector contains a Pmyo-2::mCherry::myo-2_3'UTR pharyngeal marker on the backbone. Worm strains generated with vector can be crossed with strains generated with other visual markers such as in pBCN41-R4R3 which has a green fluorescent pharyngeal marker.
This is a Gateway 3-fragment compatible destination vector. It contains AttR4 and AttR3 sites (not AttR1 and AttR2 sites as identified automatically by the Addgene algorithm).
Proper citation: RRID:Addgene_34915 Copy
Species: Caenorhabditis elegans
Genetic Insert: ttTi5605 targeting
Vector Backbone Description: Vector Backbone:pDESTR4-R3; Vector Types:Worm targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22290181
Proper citation: RRID:Addgene_34866 Copy
Species: Homo sapiens
Genetic Insert: PIMT
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5400; Vector Backbone:pET30b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18318686
Proper citation: RRID:Addgene_34852 Copy
Species: Homo sapiens
Genetic Insert: Ube1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:PET21d; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21771579
Proper citation: RRID:Addgene_34965 Copy
Genetic Insert: TCF binding sites
Vector Backbone Description: Backbone Size:8000; Vector Backbone:pJIM20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18724937
Comments: Seven copies of the TCF binding site, AGATCAAAGG, were transferred from Super8XTOPflash (plasmid M50) (Veeman et al., 2003) into Fire lab vector L3135 to place them downstream of the pes-10 minimal promoter. The seven TCF sites and the pes-10 minimal promoter were amplified using forward primer AAGCTTGGTACCGAGCTCGG and reverse primer ATGCCTAGGCAATCAATGCCTGAAAGTTAAAAATTAC. The product was then cloned into mCherry plasmid (PJIM20) with let-858 3’ UTR (kind gift from Jon Audhya) using sites SpeI and AvrII.
There is a known sequence discrepancy between the depositor's and Addgene's sequence, which does not alter the function of this plasmid.
Proper citation: RRID:Addgene_34848 Copy
Vector Backbone Description: Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201
Proper citation: RRID:Addgene_34931 Copy
Species: Homo sapiens
Genetic Insert: p110β
Vector Backbone Description: Backbone Marker:Aoki et al., PNAS. 1998 Dec 8;95(25):14950-5; Backbone Size:2949; Vector Backbone:pBSFI; Vector Types:Adaptor plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16432180
Proper citation: RRID:Addgene_34891 Copy
Vector Backbone Description: Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201
Proper citation: RRID:Addgene_34935 Copy
Vector Backbone Description: Backbone Size:2961; Vector Backbone:pBluescriptII; Vector Types:Moss Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18803774
Comments: Scientists using this plasmid in a publication should acknowledge Drs. Tomoaki Nishiyama and Mitsuyasu Hasebe in the publication.
Proper citation: RRID:Addgene_34888 Copy
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21868676
Comments: To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain BL21. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy.
Proper citation: RRID:Addgene_34929 Copy
Species: Mus musculus
Genetic Insert: LIM homeobox transcription factor 1-beta
Vector Backbone Description: Backbone Marker:Malin Parmar; Backbone Size:7041; Vector Backbone:pCCL-cppt-PGK-WPRE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21646515
Proper citation: RRID:Addgene_34997 Copy
Species: Streptococcus pyogenes
Genetic Insert: SpyCatcher
Vector Backbone Description: Vector Backbone:pDEST14; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22366317
Proper citation: RRID:Addgene_35044 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ePDZb1–mCherry
Vector Backbone Description: Vector Backbone:YIPlac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22388287
Proper citation: RRID:Addgene_34981 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ePDZb–mCherry
Vector Backbone Description: Vector Backbone:YIPlac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22388287
Proper citation: RRID:Addgene_34980 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Mid2(SS/TM)-GFP-LOVpep
Vector Backbone Description: Backbone Size:4263; Vector Backbone:YIPlac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22388287
Comments: The LOV2 domain is amino acids 404-540 and differs from the wild-type A. sativa LOV2 sequence by the point mutations G528A and N534E. See Strickland et al. for details.
Proper citation: RRID:Addgene_34971 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.