Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: MKK7b1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9891090
Proper citation: RRID:Addgene_14622 Copy
Species: Mus musculus
Genetic Insert: ERK1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: T7 tag is MASMTGGQQMG.
Made by Sejeong Shin.
Proper citation: RRID:Addgene_14440 Copy
Species: Mus musculus
Genetic Insert: MKK7a1(Glu)
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9207092
Proper citation: RRID:Addgene_14540 Copy
Species: Mus musculus
Genetic Insert: MKK7a1(Ala)
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9207092
Proper citation: RRID:Addgene_14539 Copy
Species: Mus musculus
Genetic Insert: PECAM promoter/enhancer
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4500; Vector Backbone:EGFP-1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17068148
Proper citation: RRID:Addgene_14689 Copy
Species: Mus musculus
Genetic Insert: PECAM promoter/enhancer
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5800; Vector Backbone:EGFP-1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:14982871
Proper citation: RRID:Addgene_14686 Copy
Species: Mus musculus
Genetic Insert: Hmga2 wt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).
Proper citation: RRID:Addgene_14789 Copy
Species: Mus musculus
Genetic Insert: Luc-wt
Vector Backbone Description: Backbone Marker:Available from Addgene (#12179); Backbone Size:4000; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.
Proper citation: RRID:Addgene_14785 Copy
Species: Mus musculus
Genetic Insert: Myf5
Vector Backbone Description: Backbone Size:5300; Vector Backbone:EMSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10733231
Proper citation: RRID:Addgene_14711 Copy
Species: Mus musculus
Genetic Insert: MyoD
Vector Backbone Description: Backbone Size:5300; Vector Backbone:EMSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10733231
Proper citation: RRID:Addgene_14710 Copy
Species: Mus musculus
Genetic Insert: Hmga2 truncated
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).
Proper citation: RRID:Addgene_14793 Copy
Species: Mus musculus
Genetic Insert: MKK7b1(Glu)
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9891090
Proper citation: RRID:Addgene_14673 Copy
Species: Mus musculus
Genetic Insert: K-ras 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4045; Vector Backbone:pRL-TK; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Proper citation: RRID:Addgene_14804 Copy
Species: Mus musculus
Genetic Insert: Mer
Vector Backbone Description: Backbone Marker:BD Biosciences; Backbone Size:5300; Vector Backbone:pIRES2-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15673687
Comments: The full-length mouse Mer (994 amino acids) was cloned from a 16-day-old mouse embryo cDNA library. Addgene's quality control found the closest match to the insert sequence is mouse Mer (AA17-994) Sequence ID: NP_032613.1, with mutations I516V and Q860R. The plasmid should function as described in the associated article listed on the plasmid page above.
Proper citation: RRID:Addgene_14998 Copy
Species: Mus musculus
Genetic Insert: RTP1S
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32610120
Comments: bioRxiv https://www.biorxiv.org/content/10.1101/803908v2
Proper citation: RRID:Addgene_149364 Copy
Species: Mus musculus
Genetic Insert: Olfr644
Vector Backbone Description: Vector Backbone:pME18S; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32610120
Comments: Please visit https://www.biorxiv.org/content/10.1101/803908v2 for bioRxiv preprint. bioRxiv https://www.biorxiv.org/content/10.1101/803908v2
Proper citation: RRID:Addgene_149365 Copy
Species: Mus musculus
Genetic Insert: Neuroligin 1
Vector Backbone Description: Backbone Size:4921; Vector Backbone:pCAAGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16846852
Comments: There is a A43V mutation in the aa acid sequence. The mutation is within the signal sequence and our data demonstrate that cleavage is normal. That means the mature protein does not have any change in amino acid sequence.
Proper citation: RRID:Addgene_15260 Copy
Species: Mus musculus
Genetic Insert: beta2-YFP-M
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5500; Vector Backbone:pCI-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14684858
Comments: YFP with an upstream HA epitope tag was inserted into PpuMI restriction site of the (M3-M4) loop at residue 381 (beta2-YFP-M).
Proper citation: RRID:Addgene_15107 Copy
Species: Mus musculus
Genetic Insert: Neuroligin 1 with insert A
Vector Backbone Description: Backbone Size:4842; Vector Backbone:pCAAGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16846852
Proper citation: RRID:Addgene_15227 Copy
Species: Mus musculus
Genetic Insert: PRKACA
Vector Backbone Description: Backbone Marker:Dr. Richard Palmiter; Backbone Size:4100; Vector Backbone:Zem3 (pUC13 + MT prom + hGH polyA); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3667630
Comments: Zem3 is a pUC13 derivative that contains a mouse metallothionein-I promoter and the human growth hormone pol(A) region separated by a BglII restriction site. pCalpha EV was constructed by isolating the 1318 base pair NaeI/PvuII fragment of pMCalpha and inserting it into the BglII site of Zem3 after ligation of BamHI linkers onto the cDNA insert.
The coding sequence can be cut out with NcoI and ApaI, which should release a 1152bp fragment.
Proper citation: RRID:Addgene_15310 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
