Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 293 showing 5841 ~ 5860 out of 12,972 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_14622

    This resource has 1+ mentions.

http://www.addgene.org/14622

Species: Mus musculus
Genetic Insert: MKK7b1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9891090

Proper citation: RRID:Addgene_14622 Copy   


  • RRID:Addgene_14440

    This resource has 1+ mentions.

http://www.addgene.org/14440

Species: Mus musculus
Genetic Insert: ERK1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: T7 tag is MASMTGGQQMG. Made by Sejeong Shin.

Proper citation: RRID:Addgene_14440 Copy   


  • RRID:Addgene_14540

    This resource has 1+ mentions.

http://www.addgene.org/14540

Species: Mus musculus
Genetic Insert: MKK7a1(Glu)
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9207092

Proper citation: RRID:Addgene_14540 Copy   


  • RRID:Addgene_14539

    This resource has 1+ mentions.

http://www.addgene.org/14539

Species: Mus musculus
Genetic Insert: MKK7a1(Ala)
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9207092

Proper citation: RRID:Addgene_14539 Copy   


  • RRID:Addgene_14689

    This resource has 1+ mentions.

http://www.addgene.org/14689

Species: Mus musculus
Genetic Insert: PECAM promoter/enhancer
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4500; Vector Backbone:EGFP-1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17068148

Proper citation: RRID:Addgene_14689 Copy   


  • RRID:Addgene_14686

    This resource has 1+ mentions.

http://www.addgene.org/14686

Species: Mus musculus
Genetic Insert: PECAM promoter/enhancer
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5800; Vector Backbone:EGFP-1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:14982871

Proper citation: RRID:Addgene_14686 Copy   


  • RRID:Addgene_14789

    This resource has 1+ mentions.

http://www.addgene.org/14789

Species: Mus musculus
Genetic Insert: Hmga2 wt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).

Proper citation: RRID:Addgene_14789 Copy   


http://www.addgene.org/14785

Species: Mus musculus
Genetic Insert: Luc-wt
Vector Backbone Description: Backbone Marker:Available from Addgene (#12179); Backbone Size:4000; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.

Proper citation: RRID:Addgene_14785 Copy   


  • RRID:Addgene_14711

    This resource has 1+ mentions.

http://www.addgene.org/14711

Species: Mus musculus
Genetic Insert: Myf5
Vector Backbone Description: Backbone Size:5300; Vector Backbone:EMSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10733231

Proper citation: RRID:Addgene_14711 Copy   


  • RRID:Addgene_14710

    This resource has 1+ mentions.

http://www.addgene.org/14710

Species: Mus musculus
Genetic Insert: MyoD
Vector Backbone Description: Backbone Size:5300; Vector Backbone:EMSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10733231

Proper citation: RRID:Addgene_14710 Copy   


  • RRID:Addgene_14793

http://www.addgene.org/14793

Species: Mus musculus
Genetic Insert: Hmga2 truncated
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).

Proper citation: RRID:Addgene_14793 Copy   


http://www.addgene.org/14673

Species: Mus musculus
Genetic Insert: MKK7b1(Glu)
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9891090

Proper citation: RRID:Addgene_14673 Copy   


  • RRID:Addgene_14804

    This resource has 1+ mentions.

http://www.addgene.org/14804

Species: Mus musculus
Genetic Insert: K-ras 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4045; Vector Backbone:pRL-TK; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365

Proper citation: RRID:Addgene_14804 Copy   


  • RRID:Addgene_14998

    This resource has 1+ mentions.

http://www.addgene.org/14998

Species: Mus musculus
Genetic Insert: Mer
Vector Backbone Description: Backbone Marker:BD Biosciences; Backbone Size:5300; Vector Backbone:pIRES2-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15673687
Comments: The full-length mouse Mer (994 amino acids) was cloned from a 16-day-old mouse embryo cDNA library. Addgene's quality control found the closest match to the insert sequence is mouse Mer (AA17-994) Sequence ID: NP_032613.1, with mutations I516V and Q860R. The plasmid should function as described in the associated article listed on the plasmid page above.

Proper citation: RRID:Addgene_14998 Copy   


  • RRID:Addgene_149364

http://www.addgene.org/149364

Species: Mus musculus
Genetic Insert: RTP1S
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32610120
Comments: bioRxiv https://www.biorxiv.org/content/10.1101/803908v2

Proper citation: RRID:Addgene_149364 Copy   


  • RRID:Addgene_149365

http://www.addgene.org/149365

Species: Mus musculus
Genetic Insert: Olfr644
Vector Backbone Description: Vector Backbone:pME18S; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32610120
Comments: Please visit https://www.biorxiv.org/content/10.1101/803908v2 for bioRxiv preprint. bioRxiv https://www.biorxiv.org/content/10.1101/803908v2

Proper citation: RRID:Addgene_149365 Copy   


  • RRID:Addgene_15260

    This resource has 10+ mentions.

http://www.addgene.org/15260

Species: Mus musculus
Genetic Insert: Neuroligin 1
Vector Backbone Description: Backbone Size:4921; Vector Backbone:pCAAGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16846852
Comments: There is a A43V mutation in the aa acid sequence. The mutation is within the signal sequence and our data demonstrate that cleavage is normal. That means the mature protein does not have any change in amino acid sequence.

Proper citation: RRID:Addgene_15260 Copy   


  • RRID:Addgene_15107

    This resource has 1+ mentions.

http://www.addgene.org/15107

Species: Mus musculus
Genetic Insert: beta2-YFP-M
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5500; Vector Backbone:pCI-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14684858
Comments: YFP with an upstream HA epitope tag was inserted into PpuMI restriction site of the (M3-M4) loop at residue 381 (beta2-YFP-M).

Proper citation: RRID:Addgene_15107 Copy   


  • RRID:Addgene_15227

    This resource has 1+ mentions.

http://www.addgene.org/15227

Species: Mus musculus
Genetic Insert: Neuroligin 1 with insert A
Vector Backbone Description: Backbone Size:4842; Vector Backbone:pCAAGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16846852

Proper citation: RRID:Addgene_15227 Copy   


http://www.addgene.org/15310

Species: Mus musculus
Genetic Insert: PRKACA
Vector Backbone Description: Backbone Marker:Dr. Richard Palmiter; Backbone Size:4100; Vector Backbone:Zem3 (pUC13 + MT prom + hGH polyA); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3667630
Comments: Zem3 is a pUC13 derivative that contains a mouse metallothionein-I promoter and the human growth hormone pol(A) region separated by a BglII restriction site. pCalpha EV was constructed by isolating the 1318 base pair NaeI/PvuII fragment of pMCalpha and inserting it into the BglII site of Zem3 after ligation of BamHI linkers onto the cDNA insert. The coding sequence can be cut out with NcoI and ApaI, which should release a 1152bp fragment.

Proper citation: RRID:Addgene_15310 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X