Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 295 showing 5881 ~ 5900 out of 740,321 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/49064

Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24339991
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.

Proper citation: RRID:Addgene_49064 Copy   


http://www.addgene.org/49063

Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24339991
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.

Proper citation: RRID:Addgene_49063 Copy   


http://www.addgene.org/49068

Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24339991
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.

Proper citation: RRID:Addgene_49068 Copy   


  • RRID:Addgene_49101

    This resource has 1+ mentions.

http://www.addgene.org/49101

Species: rabies virus
Genetic Insert: Cerulean-E2A-RG
Vector Backbone Description: Backbone Marker:Callaway Addgene 26197; Vector Backbone:pAAV-EF1a-FLEX-GTB; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Comments: GFP-2A-TVA in pAAV-EF1a-Flex-GTB is replaced with cerulean.

Proper citation: RRID:Addgene_49101 Copy   


  • RRID:Addgene_49055

    This resource has 1+ mentions.

http://www.addgene.org/49055

Species: Aequorea victoria green
Genetic Insert: eGFP
Vector Backbone Description: Backbone Size:6204; Vector Backbone:adeno-associated viral (AAVsp); Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11842206
Comments: Expression of GFP is driven by a CMV promoter with a splice donor/acceptor sequence (SD/SA) and flanked by inverted terminal repeats (ITRs).

Proper citation: RRID:Addgene_49055 Copy   


  • RRID:Addgene_37228

http://www.addgene.org/37228

Species: Saccharomyces cerevisiae
Genetic Insert: eIF4E
Vector Backbone Description: Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040

Proper citation: RRID:Addgene_37228 Copy   


  • RRID:Addgene_37229

http://www.addgene.org/37229

Species: Saccharomyces cerevisiae
Genetic Insert: eIF4E
Vector Backbone Description: Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040

Proper citation: RRID:Addgene_37229 Copy   


  • RRID:Addgene_37221

http://www.addgene.org/37221

Species: Saccharomyces cerevisiae
Genetic Insert: eIF5B
Vector Backbone Description: Vector Backbone:pSKB3; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17913637

Proper citation: RRID:Addgene_37221 Copy   


  • RRID:Addgene_37222

http://www.addgene.org/37222

Species: Saccharomyces cerevisiae
Genetic Insert: HHtRNA
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637
Comments: HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG

Proper citation: RRID:Addgene_37222 Copy   


http://www.addgene.org/37183

Vector Backbone Description: Backbone Size:6025; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. 2K-T has a TEV-cleavable N-terminal His6 and MBP fusion tag to enhance solubility and ease purification. These tags are preceded by a periplasmic locator signal, which is autocleaved during secretion. The PPL tag may be helpful if your protein binds to or interferes with intracellular E. coli molecules, since your protein of interest is safely sequestered in the periplasm. It may also be helpful if your protein of interest is more stable in the periplasmic environment. Protein purification may also be made simpler using this expression method. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_37183 Copy   


http://www.addgene.org/37184

Vector Backbone Description: Backbone Marker:CLONTECH; Backbone Size:4810; Vector Backbone:pDIRECT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747757
Comments: For more information on Pelczar TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#pelczar

Proper citation: RRID:Addgene_37184 Copy   


  • RRID:Addgene_37192

http://www.addgene.org/37192

Species: Homo sapiens
Genetic Insert: EDD C2768A
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4225; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12011095
Comments: The depositing lab has noted that mutation K503R shouldn’t be a problem as it is outside the main functional domains. There does appear to be a relatively common SNP at K503 in Latino populations so this might be a genuine SNP- http://exac.broadinstitute.org/variant/8-103338864-C-T https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=rs571861064

Proper citation: RRID:Addgene_37192 Copy   


  • RRID:Addgene_37217

http://www.addgene.org/37217

Species: Saccharomyces cerevisiae
Genetic Insert: eIF1
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637

Proper citation: RRID:Addgene_37217 Copy   


  • RRID:Addgene_37219

http://www.addgene.org/37219

Species: Saccharomyces cerevisiae
Genetic Insert: eIF5
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637

Proper citation: RRID:Addgene_37219 Copy   


  • RRID:Addgene_37215

    This resource has 1+ mentions.

http://www.addgene.org/37215

Species: Mus musculus
Genetic Insert: mouse ZO-1 shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pLL5.0; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Comments: pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV.

Proper citation: RRID:Addgene_37215 Copy   


  • RRID:Addgene_37216

http://www.addgene.org/37216

Species: Mus musculus
Genetic Insert: mouse ZO-1 shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pLL5.0; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Comments: pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV.

Proper citation: RRID:Addgene_37216 Copy   


  • RRID:Addgene_37176

http://www.addgene.org/37176

Genetic Insert: None
Vector Backbone Description: Vector Backbone:pUX3236; Vector Types:; Bacterial Resistance:Ampicillin
Comments: This strain contains Roberts lab plasmid pUX3236 which is pUX2424 (contains ~1200bp fragment from Burkholderia xenovorans LB400 with introduced terminal HindIII and SalI sites [such that HindIII – (<-rcoM1– intergenic region – coxM1′->) – SalI]) but with a higher-affinity “e↑” binding site (5′-TCCTACAGTTCACGCACGT-3′). Suitable template for amplification and mutagenesis. For strain usage see attached pdf. Please note that this strain has not been confirmed by Addgene functionally.

Proper citation: RRID:Addgene_37176 Copy   


  • RRID:Addgene_37177

http://www.addgene.org/37177

Species: Burkholderia xenovorans
Genetic Insert: coxM1′::lacZ reporter system with higher-affinity RcoM1 binding site at the "e" position AND RcoM1 with C-term 6xHIS
Vector Backbone Description: Vector Backbone:pUX3242 and pUX2410; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Comments: This is Roberts lab strain UQ5853 (Addgene #37159) containing Roberts lab plasmids pUX3242 (pUX2996 with a coxM1′::lacZ reporter system such that ...vector DNA – BamHI (unique site) – higher-affinity binding site at the “e” position (“e↑” binding site = 5′-TCCTACAGTTCACGCACGT-3′) – coxM1′(with unique SalI site)::lacZ-> tfd <-KanR (with 5′-end unique XhoI site) – vector DNA <-SpR...) AND pUX2410 (for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag). The strain is CmR, pUX3242 is KanR and SpecR and pUX2410 is AmpR. Can be grown in Amp + Kan. For strain usage see attached pdf.

Proper citation: RRID:Addgene_37177 Copy   


  • RRID:Addgene_37210

http://www.addgene.org/37210

Species: canine
Genetic Insert: dog ZO-2 shRNA
Vector Backbone Description: Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19605556

Proper citation: RRID:Addgene_37210 Copy   


  • RRID:Addgene_37178

http://www.addgene.org/37178

Genetic Insert: coxM1′::lacZ reporter system with RcoM binding sites "a-f" spaced at 21bp AND RcoM1 with C-term 6xHIS tag
Vector Backbone Description: Vector Backbone:pUX3254 AND pUX2410; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Comments: This is Roberts lab strain UQ5853 (Addgene #37159) containing Roberts lab plasmids pUX3254 (coxM1′::lacZ reporter system with binding sites “a-f” with a deletion between the “c” and “d” binding motifs such that the individual binding motifs “a,” “b,” “c,” “d,” “e,” and “f” are spaced at 21-bp intervals) AND pUX2410 (for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag). Strain is CmR, pUX3254 is KanR and SpecR, pUX2410 is AmpR. Can be grown in Amp + Kan. For strain usage see attached pdf.

Proper citation: RRID:Addgene_37178 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X