Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: autophagy-related 12 (yeast)
Vector Backbone Description: Backbone Size:6300; Vector Backbone:pMSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20723759
Proper citation: RRID:Addgene_27050 Copy
Species: Homo sapiens
Genetic Insert: mCherry and ZAP70 (residues 1-259)
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pHR'; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21135224
Proper citation: RRID:Addgene_27137 Copy
Species: Homo sapiens
Genetic Insert: CK2alpha
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4952; Vector Backbone:pGEX-3X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21036246
Proper citation: RRID:Addgene_27083 Copy
Genetic Insert: MS2 binding sites (6)
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:3422; Vector Backbone:pSL1180; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9809065
Comments: The Singer Lab no longer recommends this plasmid, as it has a higher rate of bacterial recombination.
For mammalian cells they recommend the following plasmids:
pUbC-FLAG-24xSuntagV4-oxEBFP-AID-baUTR1-24xMS2V5-Wpre (Plasmid #84561)
HaloTag-bActinCDS-bActinUTR-MS2V5 (Plasmid #102718)
For yeast cells they recommend the following plasmids:
pET246-pUC57 12xMS2V6 (Plasmid #104390)
pET259-pUC57 24xMS2V6 (Plasmid #104391)
pET251-pUC 12xMS2V6 Loxp KANr Loxp (Plasmid #104392)
pET264-pUC 24xMS2V6 Loxp KANr Loxp (Plasmid #104393)
Loop sequence: acatgaggatcacccatgt
Addgene's sequencing result contains 1 nucleotide mismatch at bp# 345 when compared to the full plasmid sequence provided by the depositing laboratory.
Proper citation: RRID:Addgene_27118 Copy
Species: Homo sapiens
Genetic Insert: CK2beta
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21036246
Proper citation: RRID:Addgene_27085 Copy
Species: Homo sapiens
Genetic Insert: MKL2
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:0; Vector Backbone:p3XFLAG-CMV7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14565952
Proper citation: RRID:Addgene_27175 Copy
Species: Homo sapiens
Genetic Insert: ATF6
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10856300
Comments: This is the activated (nuclear) form of ATF6.
Please note that mutation M13I in ATF6 was found during Addgene's quality control. The plasmid should function as described in the associated publication above.
Proper citation: RRID:Addgene_27173 Copy
Species: Mus musculus
Genetic Insert: Merlin
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20178741
Proper citation: RRID:Addgene_27104 Copy
Species: Homo sapiens
Genetic Insert: αTubulin K40 acetyltransferase
Vector Backbone Description: Backbone Size:4981; Vector Backbone:pGEX-6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21068373
Proper citation: RRID:Addgene_27101 Copy
Species: Mus musculus
Genetic Insert: shRNA MKL1+2
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20466732
Comments: shRNA sequence for knockdown of both MKL1 and MKL2: CATGGAGCTGGTGGAGAAGAA
Proper citation: RRID:Addgene_27161 Copy
Species: Homo sapiens
Genetic Insert: ELK1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20466732
Proper citation: RRID:Addgene_27156 Copy
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:9941; Vector Backbone:pFUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15608064
Comments: For rodent cortex pyramidal neuron-specific expression of EGFP under the synapsin I promoter (1.1kb fragment)
Proper citation: RRID:Addgene_27232 Copy
Genetic Insert: DsRed2
Vector Backbone Description: Backbone Size:9066; Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15608064
Comments: Expresses tandem dimer RFP under the mouse α-CaMKII promoter (1.3kb fragment). Similar to plasmid # 27230, except for fluorescent tag.
Note that differences between Addgene's sequencing result and the sequence from the depositing scientist are due to use of theoretical maps. Please utilize Addgene's sequence when available.
EcoRI and BstBI sites are not present according to Addgene's sequencing results.
Proper citation: RRID:Addgene_27233 Copy
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:9941; Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15608064
Comments: For rodent cortex pyramidal neuron-specific expression of EGFP under the mouse α-CaMKII promoter (1.3kb fragment)
Proper citation: RRID:Addgene_27230 Copy
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:9941; Vector Backbone:pFUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15608064
Comments: Expresses EGFP under the synapsin I promoter
Proper citation: RRID:Addgene_27231 Copy
Species: Aequorea
Genetic Insert: GFP
Vector Backbone Description: Backbone Size:7860; Vector Backbone:pCLX; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23097121
Proper citation: RRID:Addgene_27245 Copy
Species: Entacmaea
Genetic Insert: TurboRFP
Vector Backbone Description: Backbone Size:7932; Vector Backbone:pCLX; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29079819
Proper citation: RRID:Addgene_27246 Copy
Species: Rattus norvegicus
Genetic Insert: AMP Acticated Protein Kinase
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pMIGR; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_27296 Copy
Species: Homo sapiens
Genetic Insert: protein kinase B beta
Vector Backbone Description: Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_27294 Copy
Species: Homo sapiens
Genetic Insert: protein kinase B beta
Vector Backbone Description: Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Comments: There is a silent mutation at nt552 (CGG->CGA) of the depositor's seq. This mutation does not alter the amino acid sequence.
Proper citation: RRID:Addgene_27295 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
