Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pMSCV FHA-Stop Resource Report Resource Website 1+ mentions |
RRID:Addgene_27050 | autophagy-related 12 (yeast) | Mus musculus | Ampicillin | PMID:20723759 | Backbone Size:6300; Vector Backbone:pMSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | changed glycine 141 to stop codon. | 2026-08-15 01:12:59 | 1 | |
|
pHR-mCherry-tSH2(ZAP70) Resource Report Resource Website 1+ mentions |
RRID:Addgene_27137 | mCherry and ZAP70 (residues 1-259) | Homo sapiens | Ampicillin | PMID:21135224 | Backbone Size:9000; Vector Backbone:pHR'; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:00 | 2 | ||
|
pDB1 (CK2alpha) Resource Report Resource Website 1+ mentions |
RRID:Addgene_27083 | CK2alpha | Homo sapiens | Ampicillin | PMID:21036246 | Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4952; Vector Backbone:pGEX-3X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:59 | 7 | ||
|
pSL-MS2-6X Resource Report Resource Website 10+ mentions |
RRID:Addgene_27118 | MS2 binding sites (6) | Ampicillin | PMID:9809065 | The Singer Lab no longer recommends this plasmid, as it has a higher rate of bacterial recombination. For mammalian cells they recommend the following plasmids: pUbC-FLAG-24xSuntagV4-oxEBFP-AID-baUTR1-24xMS2V5-Wpre (Plasmid #84561) HaloTag-bActinCDS-bActinUTR-MS2V5 (Plasmid #102718) For yeast cells they recommend the following plasmids: pET246-pUC57 12xMS2V6 (Plasmid #104390) pET259-pUC57 24xMS2V6 (Plasmid #104391) pET251-pUC 12xMS2V6 Loxp KANr Loxp (Plasmid #104392) pET264-pUC 24xMS2V6 Loxp KANr Loxp (Plasmid #104393) Loop sequence: acatgaggatcacccatgt Addgene's sequencing result contains 1 nucleotide mismatch at bp# 345 when compared to the full plasmid sequence provided by the depositing laboratory. | Backbone Marker:Pharmacia; Backbone Size:3422; Vector Backbone:pSL1180; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:59 | 13 | ||
|
pAB46 (CK2beta) Resource Report Resource Website 1+ mentions |
RRID:Addgene_27085 | CK2beta | Homo sapiens | Kanamycin | PMID:21036246 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:59 | 1 | ||
|
p3XFLAG-MKL2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27175 | MKL2 | Homo sapiens | Ampicillin | PMID:14565952 | Backbone Marker:Sigma; Backbone Size:0; Vector Backbone:p3XFLAG-CMV7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:00 | 3 | ||
|
pCGN-ATF6 (1-373) Resource Report Resource Website 10+ mentions |
RRID:Addgene_27173 | ATF6 | Homo sapiens | Ampicillin | PMID:10856300 | This is the activated (nuclear) form of ATF6. Please note that mutation M13I in ATF6 was found during Addgene's quality control. The plasmid should function as described in the associated publication above. | Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Contains only aa 1-373 (please see depositor comments below) | 2026-08-15 01:13:00 | 14 |
|
pRK5-Flag-HA-Merlin Resource Report Resource Website 1+ mentions |
RRID:Addgene_27104 | Merlin | Mus musculus | Ampicillin | PMID:20178741 | Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:59 | 1 | ||
|
pGEX-αTAT1[2-236] Resource Report Resource Website 1+ mentions |
RRID:Addgene_27101 | αTubulin K40 acetyltransferase | Homo sapiens | Ampicillin | PMID:21068373 | Backbone Size:4981; Vector Backbone:pGEX-6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:59 | 1 | ||
|
pLKO.1-MKL1/2 shRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_27161 | shRNA MKL1+2 | Mus musculus | Ampicillin | PMID:20466732 | shRNA sequence for knockdown of both MKL1 and MKL2: CATGGAGCTGGTGGAGAAGAA | Backbone Size:0; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:00 | 5 | |
|
pCGN-ELK-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27156 | ELK1 | Homo sapiens | Ampicillin | PMID:20466732 | Backbone Size:0; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:00 | 6 | ||
|
pFSy(1.1)GW Resource Report Resource Website 10+ mentions |
RRID:Addgene_27232 | EGFP | Ampicillin | PMID:15608064 | For rodent cortex pyramidal neuron-specific expression of EGFP under the synapsin I promoter (1.1kb fragment) | Backbone Size:9941; Vector Backbone:pFUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 10 | ||
|
pFCK(1.3)tdimer2W Resource Report Resource Website 1+ mentions |
RRID:Addgene_27233 | DsRed2 | Ampicillin | PMID:15608064 | Expresses tandem dimer RFP under the mouse α-CaMKII promoter (1.3kb fragment). Similar to plasmid # 27230, except for fluorescent tag. Note that differences between Addgene's sequencing result and the sequence from the depositing scientist are due to use of theoretical maps. Please utilize Addgene's sequence when available. EcoRI and BstBI sites are not present according to Addgene's sequencing results. | Backbone Size:9066; Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 1 | ||
|
pFCK(1.3)GW Resource Report Resource Website 1+ mentions |
RRID:Addgene_27230 | EGFP | Ampicillin | PMID:15608064 | For rodent cortex pyramidal neuron-specific expression of EGFP under the mouse α-CaMKII promoter (1.3kb fragment) | Backbone Size:9941; Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:00 | 3 | ||
|
pFSy(336)GW Resource Report Resource Website 1+ mentions |
RRID:Addgene_27231 | EGFP | Ampicillin | PMID:15608064 | Expresses EGFP under the synapsin I promoter | Backbone Size:9941; Vector Backbone:pFUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 1 | ||
|
pCLX-UBI-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_27245 | GFP | Aequorea | Ampicillin | PMID:23097121 | Backbone Size:7860; Vector Backbone:pCLX; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 5 | ||
|
pCLX-UBI-Tred Resource Report Resource Website 1+ mentions |
RRID:Addgene_27246 | TurboRFP | Entacmaea | Ampicillin | PMID:29079819 | Backbone Size:7932; Vector Backbone:pCLX; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 1 | ||
|
pMIGR AMPK KD Resource Report Resource Website 1+ mentions |
RRID:Addgene_27296 | AMP Acticated Protein Kinase | Rattus norvegicus | Ampicillin | Backbone Size:6000; Vector Backbone:pMIGR; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Kinase Dead = Lys 45 to Arg | 2026-08-15 01:13:01 | 2 | ||
|
pLNCX1 Myr AKT2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27294 | protein kinase B beta | Homo sapiens | Ampicillin | Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | PH domain deleted (aa1-107) | 2026-08-15 01:13:01 | 2 | ||
|
pLNCX1 HA AKT2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27295 | protein kinase B beta | Homo sapiens | Ampicillin | There is a silent mutation at nt552 (CGG->CGA) of the depositor's seq. This mutation does not alter the amino acid sequence. | Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
