Plasmids   Select Another Resource Report Type

http://www.addgene.org/71461

Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET21(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16074986
Comments: This plasmid contains the CAT gene, which can be replaced with your gene of interest using the unique BsrG I site (TGTACA) at the end of the intein and one of several sites downstream from the product protein (typically Hind III). More info on cloning can be found in supplemental document ELP cloning manual. Please NOTE- the Addgene diagnostic digest result confirms the presence of ELP-intein.

Proper citation: RRID:Addgene_71461 Copy   

•   Source: Addgene

http://www.addgene.org/71504

Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3-Promoter; Vector Types:Insect Expression, flySTARR-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:25517091
Comments: This plasmid was made by replacing the sequence of pGL3-Promoter between BglII and FseI with a fragment containing the core promoter listed above, an mhc16 intron, an ORF (sgGFP, Qbiogene, Inc), a ccdB suicide gene flanked by homology arms (used for cloning the enhancer candidates during library generation), followed by the pGL3's SV40 late polyA-signal.

Proper citation: RRID:Addgene_71504 Copy   

•   Source: Addgene

http://www.addgene.org/71453

Species: Homo sapiens
Genetic Insert: STAT1
Vector Backbone Description: Backbone Marker:Andrei Gudkov lab; Vector Backbone:pLV-tetO-CMV-SV40-puro-LoxP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19478064

Proper citation: RRID:Addgene_71453 Copy   

•   Source: Addgene

http://www.addgene.org/71458

Species: Mus musculus
Genetic Insert: Slc1a5
Vector Backbone Description: Backbone Marker:Obtained from Dr. Inder Verma and modified in Dr. Shao-Cong's lab. Addgene Plasmid #27557; Backbone Size:8000; Vector Backbone:pCLXSN-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24792914
Comments: We transferred the Slc1a5 insert from the pCLXSN vector. The differences in Slc1a5 compared to GenBank reference sequence NM_009201.2 do not affect the function of the plasmid.

Proper citation: RRID:Addgene_71458 Copy   

•   Source: Addgene

http://www.addgene.org/71484

Genetic Insert: sgPal7
Vector Backbone Description: Vector Backbone:p2Tol2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26527385

Proper citation: RRID:Addgene_71484 Copy   

•   Source: Addgene

http://www.addgene.org/71485

Vector Backbone Description: Vector Backbone:p2Tol2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26527385

Proper citation: RRID:Addgene_71485 Copy   

•   Source: Addgene

http://www.addgene.org/71401

Species: Homo sapiens
Genetic Insert: HDAC4 1-129
Vector Backbone Description: Backbone Marker:Addgene plasmid #11160; Backbone Size:4798; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26272629

Proper citation: RRID:Addgene_71401 Copy   

•   Source: Addgene

http://www.addgene.org/71489

Genetic Insert: spCas9
Vector Backbone Description: Vector Backbone:p2Tol2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26527385

Proper citation: RRID:Addgene_71489 Copy   

•   Source: Addgene

http://www.addgene.org/71486

Species: Synthetic
Genetic Insert: loxP-hyg-loxP cassette
Vector Backbone Description: Backbone Marker:Kenan Murphy; Backbone Size:2741; Vector Backbone:pKM328; Vector Types:Bacterial Expression, Source of loxP-hyg-loxP for PCR amplification.; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25779316
Comments: The floxed hyg cassette is flanked by AscI sites, which can be recovered by restriction digestion for use in the construction of recombineering substrates, or amplified by PCR using the following targeting sequences: CGCTCTAGAACTAGTGGATCC ATGCCTGCAGGTCGACTC

Proper citation: RRID:Addgene_71486 Copy   

•   Source: Addgene

http://www.addgene.org/71404

Genetic Insert: aminoacyl-tRNA synthetase for a caged cysteine
Vector Backbone Description: Backbone Size:6500; Vector Backbone:pMAH2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25647354
Comments: The aminoacyl-tRNA synthetase insert contains ML42GQ compared to all available reference sequences. The depositor states that these mutations are intended and the plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_71404 Copy   

•   Source: Addgene

http://www.addgene.org/71406

Genetic Insert: Src active kinase domain inserted with Npu DnaE intein
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25647354

Proper citation: RRID:Addgene_71406 Copy   

•   Source: Addgene

http://www.addgene.org/71510

Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL4.10; Vector Types:Mammalian Expression, humanSTARR-seq validation vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:23328393
Comments: Note: The plasmid for enhancer-activity testing by luciferase assays has been used in the Arnold et al. 2013 publication. It should be replaced for all enhancer activity tests mammalian cells with the updated version reported by Muerdter et al. 2017. The improved version is Addgene plasmid # 99297. For enhancer-activity measurements in mammalian cells, please also consider the possibility of a plasmid-induced innate immune response (see Muerdter et al., 2017). Gateway-cassette was added between the KpnI and BglII sites and SCP1 between BglII and HindIII

Proper citation: RRID:Addgene_71510 Copy   

•   Source: Addgene

http://www.addgene.org/71546

Species: Mus musculus
Genetic Insert: Septin 2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15774761

Proper citation: RRID:Addgene_71546 Copy   

•   Source: Addgene

http://www.addgene.org/71549

Species: Mus musculus
Genetic Insert: Septin 2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21788367

Proper citation: RRID:Addgene_71549 Copy   

•   Source: Addgene

http://www.addgene.org/71583

Species: Homo sapiens
Genetic Insert: Septin 6
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22608511

Proper citation: RRID:Addgene_71583 Copy   

•   Source: Addgene

http://www.addgene.org/71595

Vector Backbone Description: Backbone Size:2200; Vector Backbone:pWV01; Vector Types:integration vector for bacteria; Bacterial Resistance:Erythromycin
Defining Citation: PMID:9003306
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. This plasmid has been found to be somewhat prone to multimerization. Multimerization often does not impact plasmid function, but may reduce transformation efficiencies. You may need to screen multiple colonies to isolate the monomeric version of this plasmid. If you still have trouble isolating the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.

Proper citation: RRID:Addgene_71595 Copy   

•   Source: Addgene

http://www.addgene.org/71782

Vector Backbone Description: Backbone Marker:Broad Insitute; Backbone Size:7709; Vector Backbone:pCW57.1; Vector Types:Mammalian Expression, Lentiviral, Doxycycline inducible; P2A Self Cleaving Peptide; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30795624

Proper citation: RRID:Addgene_71782 Copy   

•   Source: Addgene

http://www.addgene.org/71662

Species: Homo sapiens
Genetic Insert: hnRNPK
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5490; Vector Backbone:pcDNA3.1(+)/myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_71662 Copy   

•   Source: Addgene

http://www.addgene.org/71789

Species: Herpers Simplex Virus
Genetic Insert: Thymidine Kinase
Vector Backbone Description: Backbone Size:4456; Vector Backbone:pRS403; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17083135

Proper citation: RRID:Addgene_71789 Copy   

•   Source: Addgene

http://www.addgene.org/71666

Species: Homo sapiens
Genetic Insert: S. pyogenes dCas9 fused with the catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-EGFP
Vector Backbone Description: Backbone Size:4246; Vector Backbone:PX462; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26969735
Comments: The catalytic domain of human DNMT3A (amino acids P602-V912) was derived from the plasmid pcDNA3/Myc-DNMT3A (Addgene, plasmid #35521) (Chen et al., 2005, J Cell Biochem 95: 902-917). Undesired BbsI restriction site was removed by site-directed mutagenesis, without affecting the amino acid sequence. Plasmid pSpCas9n(BB)-2A-Puro (PX462) (Addgene, plasmid #48141) (Ran et al., 2013, Nat Protoc 8: 2281-2308) was used as a backbone. Additional H840A mutation was introduced into Cas9n D10A nickase. T2A-PuroR EcoRI fragment was replaced with T2A-EGFP fragment from pSpCas9n(BB)-2A-GFP (PX461) (Addgene, plasmid #48140) (Ran et al., 2013, Nat Protoc 8: 2281-2308).

Proper citation: RRID:Addgene_71666 Copy   

•   Source: Addgene