Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: FokI endonuclease
Vector Backbone Description: Backbone Size:5727; Vector Backbone:pMLM802; Vector Types:Mammalian Expression, zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17603475
Comments: For expression of a "-" heterodimeric FokI domain. (Miller et al., Nat Biotech 2007) in mammalian cells or zebrafish for ZFN targets with a 7bp spacer (Handel et al 2008, Mol Ther). To clone a zinc finger array into this plasmid, perform the following steps: (1) amplify the zinc finger array coding sequence from a B2H expression vector by PCR using primers OMM429 (5’-GATGACAAATCTAGACCCGGGGAGCG-3’) and OMM430 (5’-CTGCGGCCGCACCGGGTCCTGTGTGGGTTTTTAGGTG-3’), (2) digest the resulting PCR fragment with XbaI and NotI, and (3) clone the digested fragment into MLM802 vector backbone that has been digested with XbaI and NotI. The resulting plasmid will encode a ZFN that can be paired with a ZFN cloned into expression vector MLM800 to target a ZFN target site with a 7 bp spacer (Handel et al. 2008, Mol Ther.).
The difference between pMLM800/802 and pMLM290/292 is the length of the “spacer” sequence in the full ZFN target site. If the spacer is 7 bp, scientists should use pMLM800/802. If the spacer is 5 or 6 bps, scientists should use pMLM290/292.
Proper citation: RRID:Addgene_27203 Copy
Species: Danio rerio
Genetic Insert: zebrafish ubiquitin promoter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2692; Vector Backbone:pENTR5' TOPO; Vector Types:Multisite Gateway 5' entry vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21138979
Proper citation: RRID:Addgene_27320 Copy
Species: E. coli
Genetic Insert: dnaK, dnaJ
Vector Backbone Description: Backbone Size:7072; Vector Backbone:N/A; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:17565681
Comments: Please note that Addgene's sequencing results detect a single nucleotide insertion compared to depositor's sequence in the vector backbone. The plasmid expresses the expected functional protein.
Proper citation: RRID:Addgene_27392 Copy
Vector Backbone Description: Backbone Size:6127; Vector Backbone:pUC19; Vector Types:Burkholderia allelic exchange suicide vector pMo130; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19010402
Comments: Ref: EU862243
MCS-1: ApaI, NheI, BglII, SmaI, HindIII
MCS-2 NotI, PstI, BamHI, XbaI, SphI
Please note that Addgene's sequencing results identified a single nucleotide mismatch at bp# 5006, a 5 nucleotide deletion at bp# 5981-5985 and a region from bp#1010-1060 with several mismatches/deletions, when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing scientist, these differences do not affect the function of the plasmid.
Proper citation: RRID:Addgene_27388 Copy
Species: E. coli
Genetic Insert: pMo168
Vector Backbone Description: Backbone Size:7108; Vector Backbone:pBBR1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19010402
Comments: Please note that Addgene's sequencing results identified a single nucleotide mismatch at bp# 5987 and a 5 nucleotide deletion at bp# 6962-6966, when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing scientist, these differences do not affect the function of the plasmid.
Proper citation: RRID:Addgene_27389 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20868367
Proper citation: RRID:Addgene_27422 Copy
Species: Homo sapiens
Genetic Insert: unligated form of ligase ribozyme
Vector Backbone Description: Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19965478
Comments: Improved class I ligase modified at the end of P5 with four additional base pairs terminating in the U1A-
binding loop. DNA representing the unligated form of this ribozyme was
subcloned into pUC19 under a T7 transcription promoter,
followed by a genomic hepatitis delta virus (HDV) self-cleaving ribozyme and an
EarI restriction site, yielding the plasmid p307HU. The HDV sequence cleaves itself from the ribozyme 3´ terminus, thereby producing a homogenous ribozyme 3´ end. The relevant sequence of the insert was
GCGTAATACGACTCACTATAGGAACACTATACTACTGGATAATCAAAGACAAATCTGCC
CGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCTCCGGT
GGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCCTCGCT
GGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGGGACCC
AC
See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was
digested with EarI nuclease.
Proper citation: RRID:Addgene_27386 Copy
Species: Homo sapiens
Genetic Insert: Gja1
Vector Backbone Description: Backbone Size:9387; Vector Backbone:plenti6.3/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20038810
Proper citation: RRID:Addgene_27383 Copy
Genetic Insert: U6 promoter, SFFV promoter, EmeraldGFP
Vector Backbone Description: Backbone Size:6747; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27359 Copy
Genetic Insert: U6 promoter, SFFV promoter, eGFP/BSD-Fusion
Vector Backbone Description: Backbone Size:6758; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). The marker is a fusion of eGFP and Blasticidin resistance (BSD). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27354 Copy
Genetic Insert: U6 promoter, SFFV promoter, Cerulean
Vector Backbone Description: Backbone Size:6747; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27351 Copy
Species: Arabidopsis thaliana
Genetic Insert: SPL10 inverted
Vector Backbone Description: Backbone Size:0; Vector Backbone:UBI3pTpFSPGW-HYGv02; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21123653
Comments: SPL10-RNAi constructs were generated by amplifying 0.6kb
of the SPL10 CDS from cDNA prepared from inflorescence tissue total RNA isolated using TRIzol reagent (Invitrogen) and reverse-transcribed with oligo(dT) primers using SuperScript
III Reverse Transcriptase (Invitrogen). The resulting amplicons were then cloned into pCR8/GW-TOPO (Invitrogen) and then recombined with UBI3p::pFSPGW-HYGv02 to create an inverted repeat of the SPL10 cDNA fragment under the control
of the UBI3 promoter. For details regarding the UBI3p::pFSPGW-HYGv02 vector, please see the article.
Proper citation: RRID:Addgene_27409 Copy
Species: Homo sapiens
Genetic Insert: shYAP1
Vector Backbone Description: Backbone Size:8500; Vector Backbone:pLKO1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18579750
Comments: YAP shRNA sequence is - 5'-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC
Proper citation: RRID:Addgene_27368 Copy
Genetic Insert: U6 promoter, SFFV promoter, IRES-mCherry
Vector Backbone Description: Backbone Size:8150; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for the expression of a cDNA and an shRNA. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Multiple cloning site for the cDNA: BamHI, EcoRI, NotI. An internal ribosome entry site (IRES) is used to express the marker gene. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27362 Copy
Genetic Insert: U6 promoter, SFFV promoter, IRES-Venus
Vector Backbone Description: Backbone Size:8159; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for the expression of a cDNA and an shRNA. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Multiple cloning site for the cDNA: BamHI, EcoRI, SbfI, StuI, NotI. An internal ribosome entry site (IRES) is used to express the marker gene. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27360 Copy
Genetic Insert: SFFV promoter, mCherry
Vector Backbone Description: Backbone Size:6417; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for stable cell marking. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27339 Copy
Genetic Insert: SFFV promoter, Cerulean
Vector Backbone Description: Backbone Size:6417; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for stable cell marking. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27338 Copy
Genetic Insert: qtag20
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:5740; Vector Backbone:pDE43-MCKq1; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:21203517
Proper citation: RRID:Addgene_27334 Copy
Genetic Insert: SFFV promoter, IRES-Cerulean
Vector Backbone Description: Backbone Size:7829; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for the expression of a cDNA cloned into the multiple cloning site (BamHI, EcoRI, SbfI, StuI, NotI). An internal ribosome entry site (IRES) is used to express the marker gene. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27346 Copy
Genetic Insert: U6 promoter, SFFV promoter, eGFP
Vector Backbone Description: Backbone Size:6747; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27347 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
