Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: SFFV promoter, tdTomato
Vector Backbone Description: Backbone Size:6417; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for stable cell marking. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27342 Copy
Genetic Insert: SFFV promoter, IRES-tdTomato
Vector Backbone Description: Backbone Size:8540; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for the expression of a cDNA cloned into the multiple cloning site (BamHI, EcoRI, NotI). An internal ribosome entry site (IRES) is used to express the marker gene. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27343 Copy
Genetic Insert: SFFV promoter, Venus fluorescent protein
Vector Backbone Description: Backbone Size:6417; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for stable cell marking. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27340 Copy
Species: Aquifex aeolicus
Genetic Insert: leuT
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:0; Vector Backbone:pQE; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20463731
Comments: The leuT gene is codon-optimized for the expression in E. coli and designed as cassette version that contains unique restriction sites in the pQE vector background and was first described in Shi, Quick et al., 2008.
Proper citation: RRID:Addgene_27399 Copy
Species: E. coli
Genetic Insert: groESL
Vector Backbone Description: Backbone Size:0; Vector Backbone:N/A; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:17565681
Comments: Protocol for preparing proteins with improved solubility by co-expressing with molecular chaperones in Escherichia coli.
de Marco A.
Nat Protoc. 2007;2(10):2632-9.
Proper citation: RRID:Addgene_27394 Copy
Species: Homo sapiens
Genetic Insert: BRCC36
Vector Backbone Description: Backbone Size:7900; Vector Backbone:pOZ-N; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20656689
Proper citation: RRID:Addgene_27496 Copy
Species: P1 bacteriophage
Genetic Insert: Nuclear localization signal-Cre
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4200; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21179085
Comments: Although the kanamycin resistance marker is present in the full plasmid sequence, the depositing lab has never used Kan or Kan/Amp selection for this plasmid. In Addgene's experience, the kanamycin resistance is not functional. According to the Luo lab, the function of this plasmid is not affected.
Proper citation: RRID:Addgene_27493 Copy
Species: Pseudomonas phage PP7
Genetic Insert: Pseudomonas phage PP7 coat protein
Vector Backbone Description: Backbone Size:5300; Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17456562
Proper citation: RRID:Addgene_27548 Copy
Genetic Insert: mCherry_P2A_Cre recombinase
Vector Backbone Description: Backbone Size:6711; Vector Backbone:pLM (Sadelain lab); Vector Types:Lentiviral, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21151124
Proper citation: RRID:Addgene_27546 Copy
Species: Homo sapiens
Genetic Insert: TDP-43
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pRS416GAL; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19465477
Proper citation: RRID:Addgene_27458 Copy
Species: Caenorhabditis elegans
Genetic Insert: pmyo-3::yfp::lin-14_3'UTR
Vector Backbone Description: Backbone Size:2450; Vector Backbone:N/A; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20493184
Proper citation: RRID:Addgene_27505 Copy
Species: Pseudomonas aeruginosa
Genetic Insert: LasR, LasB::LacZ fusion
Vector Backbone Description: Backbone Size:0; Vector Backbone:pTS400; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8278364
Comments: Expresses LasR under the control of the lac promoter. Contains a lasB::lacZ reporter of lasB promoter activity
Proper citation: RRID:Addgene_27503 Copy
Species: Homo sapiens
Genetic Insert: TDP-43
Vector Backbone Description: Vector Backbone:pRS426 Gal; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18434538
Proper citation: RRID:Addgene_27467 Copy
Species: Homo sapiens
Genetic Insert: RAP80
Vector Backbone Description: Backbone Size:7900; Vector Backbone:pOZ-N; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20656689
Comments: There are I41V and E175G mutations in RAP80 that should not affect plasmid function.
Proper citation: RRID:Addgene_27501 Copy
Species: rabies virus
Genetic Insert: histone-GFP-2A-TVA receptor-2A-rabies glycoprotein
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2887; Vector Backbone:pAAV2-MCS; Vector Types:AAV, adeno-associated viral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21179085
Proper citation: RRID:Addgene_27437 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4874; Vector Backbone:pCMV4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10887201
Comments: This plasmid carries three copies of the influenza hemagglutinin (HA) epitope tag (YPYDVPDYA) together with restriction sites for in-frame cloning of cDNA inserts.
Proper citation: RRID:Addgene_27553 Copy
Species: Homo sapiens
Genetic Insert: Cdk2
Vector Backbone Description: Backbone Marker:M. Gossen et al., 1992 (PNAS); Backbone Size:3150; Vector Backbone:pUHD10-3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11283255
Comments: See attachment for description of backbone.
Proper citation: RRID:Addgene_27651 Copy
Vector Backbone Description: Backbone Size:2783; Vector Backbone:pUC18; Vector Types:RNA Transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12888534
Proper citation: RRID:Addgene_27663 Copy
Vector Backbone Description: Backbone Size:2776; Vector Backbone:pUC18; Vector Types:RNA Transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12888534
Proper citation: RRID:Addgene_27664 Copy
Species: Homo sapiens
Genetic Insert: human ULK2 shRNA 91
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: human ULK2 shRNA 91 TRC candidate.
shRNA oligo sequence - 5'-CCGGGTCAGTGGTATTCGCATCAAACTCGAGTTTGATGCGAATACCACTGACTTTTT - 3'
Proper citation: RRID:Addgene_27634 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
