Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 298 showing 5941 ~ 5960 out of 178,129 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/37274

Species: Mus musculus
Genetic Insert: Foxd3
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Mouse Targeting, Insertion vector for RMCE; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_37274 Copy   


  • RRID:Addgene_37280

http://www.addgene.org/37280

Species: Drosophila melanogaster
Genetic Insert: ovoD1 genomic DNA fragment
Vector Backbone Description: Backbone Size:7815; Vector Backbone:pCaSpeR 2; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8306893
Comments: Perrimon Lab plasmid #23 Please see associated publication for cloning details

Proper citation: RRID:Addgene_37280 Copy   


  • RRID:Addgene_37268

http://www.addgene.org/37268

Species: Mus musculus
Genetic Insert: Foxd3
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pPNT4; Vector Types:Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18367558

Proper citation: RRID:Addgene_37268 Copy   


  • RRID:Addgene_37301

http://www.addgene.org/37301

Species: Drosophila melanogaster
Genetic Insert: hopscotch
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7796812
Comments: Perrimon Lab plasmid #100

Proper citation: RRID:Addgene_37301 Copy   


  • RRID:Addgene_37303

http://www.addgene.org/37303

Species: Drosophila melanogaster
Genetic Insert: hopTum-1
Vector Backbone Description: Backbone Marker:Addgene plasmid# 37299; Vector Backbone:pCaShs-hopscotch; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7796812
Comments: Perrimon Lab plasmid #101 The pCaShs-Tum construct was generated by the replacement of a 220 bp SacII-BstEII fragment from pCaShs-hop (Addgene plasmid# 37299) with the same fragment of PCR-generated DNA from hopTum-1 hemizygous flies. This mutation is a G to A transversion at nucleotide 1641 resulting in the substitution of a Glu for a Gly at amino acid 341.

Proper citation: RRID:Addgene_37303 Copy   


  • RRID:Addgene_37304

http://www.addgene.org/37304

Species: Drosophila melanogaster
Genetic Insert: hopTum-1
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7796812
Comments: Perrimon Lab plasmid #102 The pUAS-Tum was made by the insertion of the NotI-XbaI fragment from pCaShs-Tum (Addgene plasmid# 37303) into pUAST.

Proper citation: RRID:Addgene_37304 Copy   


  • RRID:Addgene_37388

    This resource has 1+ mentions.

http://www.addgene.org/37388

Species: Homo sapiens
Genetic Insert: Dynactin 2
Vector Backbone Description: Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22327364
Comments: Please note that Addgene's sequencing results identified single nucleotide mismatches at bp# 2273 & 2347 when compared to the full plasmid sequence provided by the depositing laboratory. The mismatch at bp#2273 causes A7P mutation in the DCTN2 seqeuence.

Proper citation: RRID:Addgene_37388 Copy   


  • RRID:Addgene_37390

http://www.addgene.org/37390

Species: Homo sapiens
Genetic Insert: dynein light chain TcTex-type 3
Vector Backbone Description: Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22327364

Proper citation: RRID:Addgene_37390 Copy   


http://www.addgene.org/37376

Species: Drosophila melanogaster
Genetic Insert: porcupine
Vector Backbone Description: Backbone Size:7855; Vector Backbone:pCaSpeR-4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8985181
Comments: Perrimon Lab plasmid #123 The EcoRI-XbaI genomic DNA covering the porc locus was cloned in pCaspeR4 to generate a genomic porc rescue construct.

Proper citation: RRID:Addgene_37376 Copy   


  • RRID:Addgene_37377

http://www.addgene.org/37377

Species: Drosophila melanogaster
Genetic Insert: porcupine
Vector Backbone Description: Vector Backbone:pNB40; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8985181
Comments: Perrimon Lab plasmid #124

Proper citation: RRID:Addgene_37377 Copy   


  • RRID:Addgene_37404

    This resource has 1+ mentions.

http://www.addgene.org/37404

Genetic Insert: Cre Shine
Vector Backbone Description: Backbone Marker:Invitrogene; Backbone Size:5060; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_37404 Copy   


  • RRID:Addgene_37401

http://www.addgene.org/37401

Species: Drosophila melanogaster
Genetic Insert: tout-velu
Vector Backbone Description: Vector Backbone:pNB40; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9665133
Comments: Perrimon Lab plasmid #179

Proper citation: RRID:Addgene_37401 Copy   


http://www.addgene.org/37364

Species: Homo sapiens
Genetic Insert: EEF1D
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21936567

Proper citation: RRID:Addgene_37364 Copy   


  • RRID:Addgene_37366

    This resource has 1+ mentions.

http://www.addgene.org/37366

Species: Homo sapiens
Genetic Insert: npc1l1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5000; Vector Backbone:pFASTBAC; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21525977
Comments: There is a TEV cleavage site downstream of His tag.

Proper citation: RRID:Addgene_37366 Copy   


http://www.addgene.org/37504

Vector Backbone Description: Backbone Size:6053; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8O adds a TEV-cleavable His6-mOCR tag to the N-terminus of your protein. mOCR can enhance the solubility of your protein of interest. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_37504 Copy   


http://www.addgene.org/37505

Vector Backbone Description: Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through

Proper citation: RRID:Addgene_37505 Copy   


http://www.addgene.org/37506

Vector Backbone Description: Backbone Size:5693; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8R adds a TEV-cleavable strep tag to the N-terminus of your protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ .

Proper citation: RRID:Addgene_37506 Copy   


  • RRID:Addgene_37464

    This resource has 1+ mentions.

http://www.addgene.org/37464

Vector Backbone Description: Backbone Marker:Andrew Fire (Addgene plasmid # 1494); Vector Backbone:pPD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22022276

Proper citation: RRID:Addgene_37464 Copy   


  • RRID:Addgene_37460

http://www.addgene.org/37460

Species: HPV
Genetic Insert: HPV 8E6
Vector Backbone Description: Backbone Size:6550; Vector Backbone:CMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Comments: The 8E6 template was given to us by Harold Pfister who originally cloned the HPV8 genome. (J. Virology 1986, Pfister H. et al.)

Proper citation: RRID:Addgene_37460 Copy   


  • RRID:Addgene_37457

http://www.addgene.org/37457

Species: HPV
Genetic Insert: HPV 6bE6
Vector Backbone Description: Backbone Size:6550; Vector Backbone:CMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330

Proper citation: RRID:Addgene_37457 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X