Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
LeGO-T2 Resource Report Resource Website 10+ mentions |
RRID:Addgene_27342 | SFFV promoter, tdTomato | Ampicillin | PMID:18362927 | HIV-1 derived third generation lentiviral vector for stable cell marking. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de | Backbone Size:6417; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 14 | ||
|
LeGO-iT2 Resource Report Resource Website 10+ mentions |
RRID:Addgene_27343 | SFFV promoter, IRES-tdTomato | Ampicillin | PMID:18362927 | HIV-1 derived third generation lentiviral vector for the expression of a cDNA cloned into the multiple cloning site (BamHI, EcoRI, NotI). An internal ribosome entry site (IRES) is used to express the marker gene. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de | Backbone Size:8540; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:02 | 15 | ||
|
LeGO-V2 Resource Report Resource Website 10+ mentions |
RRID:Addgene_27340 | SFFV promoter, Venus fluorescent protein | Ampicillin | PMID:18362927 | HIV-1 derived third generation lentiviral vector for stable cell marking. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de | Backbone Size:6417; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:02 | 44 | ||
|
pQO18-TEV Resource Report Resource Website 1+ mentions |
RRID:Addgene_27399 | leuT | Aquifex aeolicus | Ampicillin | PMID:20463731 | The leuT gene is codon-optimized for the expression in E. coli and designed as cassette version that contains unique restriction sites in the pQE vector background and was first described in Shi, Quick et al., 2008. | Backbone Marker:Qiagen; Backbone Size:0; Vector Backbone:pQE; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:02 | 1 | |
|
pBB541 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27394 | groESL | E. coli | Spectinomycin | PMID:17565681 | Protocol for preparing proteins with improved solubility by co-expressing with molecular chaperones in Escherichia coli. de Marco A. Nat Protoc. 2007;2(10):2632-9. | Backbone Size:0; Vector Backbone:N/A; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:13:03 | 2 | |
|
pOZ-N-FH BRCC36 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27496 | BRCC36 | Homo sapiens | Ampicillin | PMID:20656689 | Backbone Size:7900; Vector Backbone:pOZ-N; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:04 | 2 | ||
|
pBT140 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27493 | Nuclear localization signal-Cre | P1 bacteriophage | Ampicillin | PMID:21179085 | Although the kanamycin resistance marker is present in the full plasmid sequence, the depositing lab has never used Kan or Kan/Amp selection for this plasmid. In Addgene's experience, the kanamycin resistance is not functional. According to the Luo lab, the function of this plasmid is not affected. | Backbone Marker:Invitrogen; Backbone Size:4200; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:04 | 5 | |
|
pETZZtevPP7CP(C68A,C73A) Resource Report Resource Website 1+ mentions |
RRID:Addgene_27548 | Pseudomonas phage PP7 coat protein | Pseudomonas phage PP7 | Kanamycin | PMID:17456562 | Backbone Size:5300; Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | changed two cysteine to alanine (C68A,C73A) to inhibit coat protein polymerization into capsid | 2026-08-15 01:13:04 | 1 | |
|
pLM-CMV-R-Cre Resource Report Resource Website 10+ mentions |
RRID:Addgene_27546 | mCherry_P2A_Cre recombinase | Ampicillin | PMID:21151124 | Backbone Size:6711; Vector Backbone:pLM (Sadelain lab); Vector Types:Lentiviral, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:04 | 21 | |||
|
pRS416 Gal TDP43 WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_27458 | TDP-43 | Homo sapiens | Ampicillin | PMID:19465477 | Backbone Size:5000; Vector Backbone:pRS416GAL; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:03 | 1 | ||
|
pHZ054 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27505 | pmyo-3::yfp::lin-14_3'UTR | Caenorhabditis elegans | Ampicillin | PMID:20493184 | Backbone Size:2450; Vector Backbone:N/A; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:04 | 1 | ||
|
pKDT17 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27503 | LasR, LasB::LacZ fusion | Pseudomonas aeruginosa | Ampicillin | PMID:8278364 | Expresses LasR under the control of the lac promoter. Contains a lasB::lacZ reporter of lasB promoter activity | Backbone Size:0; Vector Backbone:pTS400; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:03 | 3 | |
|
pRS426 Gal TDP43 GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_27467 | TDP-43 | Homo sapiens | Ampicillin | PMID:18434538 | Vector Backbone:pRS426 Gal; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:03 | 2 | ||
|
pOZ-N-FH RAP80 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27501 | RAP80 | Homo sapiens | Ampicillin | PMID:20656689 | There are I41V and E175G mutations in RAP80 that should not affect plasmid function. | Backbone Size:7900; Vector Backbone:pOZ-N; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:04 | 1 | |
|
pAAV-TRE-HTG Resource Report Resource Website 1+ mentions |
RRID:Addgene_27437 | histone-GFP-2A-TVA receptor-2A-rabies glycoprotein | rabies virus | Ampicillin | PMID:21179085 | Backbone Marker:Stratagene; Backbone Size:2887; Vector Backbone:pAAV2-MCS; Vector Types:AAV, adeno-associated viral; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:13:03 | 5 | |
|
pCMV4-HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_27553 | None | Ampicillin | PMID:10887201 | This plasmid carries three copies of the influenza hemagglutinin (HA) epitope tag (YPYDVPDYA) together with restriction sites for in-frame cloning of cDNA inserts. | Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4874; Vector Backbone:pCMV4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:04 | 4 | ||
|
pUHD Cdk2 DN HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_27651 | Cdk2 | Homo sapiens | Ampicillin | PMID:11283255 | See attachment for description of backbone. | Backbone Marker:M. Gossen et al., 1992 (PNAS); Backbone Size:3150; Vector Backbone:pUHD10-3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | D146N (Dominant Negative) | 2026-08-15 01:13:05 | 1 |
|
pRZ Resource Report Resource Website 1+ mentions |
RRID:Addgene_27663 | Ampicillin | PMID:12888534 | Backbone Size:2783; Vector Backbone:pUC18; Vector Types:RNA Transcription; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:05 | 1 | ||||
|
p2RZ Resource Report Resource Website 1+ mentions |
RRID:Addgene_27664 | Ampicillin | PMID:12888534 | Backbone Size:2776; Vector Backbone:pUC18; Vector Types:RNA Transcription; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:05 | 3 | ||||
|
pLKO human ULK2 shRNA 91 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27634 | human ULK2 shRNA 91 | Homo sapiens | Ampicillin | PMID:21205641 | human ULK2 shRNA 91 TRC candidate. shRNA oligo sequence - 5'-CCGGGTCAGTGGTATTCGCATCAAACTCGAGTTTGATGCGAATACCACTGACTTTTT - 3' | Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:04 | 3 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
