Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: human ULK1 shRNA 8
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: human ULK1 shRNA 8 TRC candidate.
shRNA oligo sequence - 5'-CCGGACATCGAGAACGTCACCAAGTCTCGAGACTTGGTGACGTTCTCGATGTTTTTT - 3'
Proper citation: RRID:Addgene_27633 Copy
Species: Mus musculus
Genetic Insert: mouse myc ULK1 4SA
Vector Backbone Description: Backbone Marker:Addgene plasmid 17399; Backbone Size:9135; Vector Backbone:pQCXIN Neo dest; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Proper citation: RRID:Addgene_27628 Copy
Genetic Insert: mCerulean C1-Gbeta
Vector Backbone Description: Backbone Size:3984; Vector Backbone:pEGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16040744
Proper citation: RRID:Addgene_27810 Copy
Species: Mus musculus
Genetic Insert: Egr2
Vector Backbone Description: Backbone Marker:A.Q. Bakker; Backbone Size:12443; Vector Backbone:LZRSpBMN-linker-IRES-EGFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_27784 Copy
Genetic Insert: Cerulean-5-Amber
Vector Backbone Description: Backbone Size:3984; Vector Backbone:pEGFP C1; Vector Types:Mammalian Expression, FRET donor control; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17040988
Comments: Control for fluorescence lifetime measurements (FLIM)
This construct contains Cerulean attached via a 5 amino acid linker to Amber. Amber was generated by mutating Tyrosine 67 in Venus to Cysteine. See supplemental methods section in associated paper for more details on plasmid construction.
Proper citation: RRID:Addgene_27799 Copy
Species: Xanthomonas
Genetic Insert: TAL-monomer-HD
Vector Backbone Description: Backbone Size:2672; Vector Backbone:pJ201; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21248753
Proper citation: RRID:Addgene_27968 Copy
Species: Xanthomonas
Genetic Insert: TAL-monomer-NI
Vector Backbone Description: Backbone Size:2672; Vector Backbone:pJ201; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21248753
Proper citation: RRID:Addgene_27966 Copy
Species: Xanthomonas
Genetic Insert: TAL-monomer-NG
Vector Backbone Description: Backbone Size:2672; Vector Backbone:pJ201; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21248753
Proper citation: RRID:Addgene_27967 Copy
Species: Xanthomonas
Genetic Insert: TAL-monomer-NN
Vector Backbone Description: Backbone Size:2672; Vector Backbone:pJ201; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21248753
Proper citation: RRID:Addgene_27965 Copy
Species: Synthetic
Genetic Insert: TAL-Backbone(NI)
Vector Backbone Description: Backbone Size:9204; Vector Backbone:pLenti; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21248753
Proper citation: RRID:Addgene_27962 Copy
Genetic Insert: TRMPV-Hygro (shLuci-1309)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:9339; Vector Backbone:pQCXIX; Vector Types:Mammalian Expression, Retroviral, RNAi, fluorescent reporters; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21131983
Proper citation: RRID:Addgene_27996 Copy
Genetic Insert: TtTMPV-Neo (shRen)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:9003; Vector Backbone:pQCXIX (modified); Vector Types:Mammalian Expression, Retroviral, RNAi, Fluorescent reporters; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21131983
Proper citation: RRID:Addgene_27993 Copy
Genetic Insert: TRMPV-ns (shRen)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7722; Vector Backbone:pQCXIX (modified); Vector Types:Mammalian Expression, Retroviral, RNAi, Fluorescent reporters; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21131983
Proper citation: RRID:Addgene_27991 Copy
Genetic Insert: TRMPV-Neo (shRen)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:9117; Vector Backbone:pQCXIX (modified); Vector Types:Mammalian Expression, Retroviral, RNAi, Fluorescent reporters; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21131983
Proper citation: RRID:Addgene_27990 Copy
Genetic Insert: FokI endonuclease
Vector Backbone Description: Backbone Size:5725; Vector Backbone:pMLM290; Vector Types:Mammalian Expression, Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17603475
Comments: For expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “+” KKR heterodimeric FokI domain. (Doyon et. al,Nat Biotech 2011) in mammalian cells or zebrafish as described by Moore et al., PLoS One 2012 (https://www.ncbi.nlm.nih.gov/pubmed/22655075) and Cade et al., Nucleic Acids Res 2012 (https://www.ncbi.nlm.nih.gov/pubmed/22684503)
Proper citation: RRID:Addgene_28062 Copy
Genetic Insert: FokI endonuclease
Vector Backbone Description: Backbone Size:5725; Vector Backbone:pMLM292; Vector Types:Mammalian Expression, Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17603475
Comments: For expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “-” ELD heterodimeric FokI domain. (Doyon et. al,Nat Biotech 2011) in mammalian cells or zebrafish as described by Moore et al., PLoS One 2012 (https://www.ncbi.nlm.nih.gov/pubmed/22655075) and Cade et al., Nucleic Acids Res 2012 (https://www.ncbi.nlm.nih.gov/pubmed/22684503)
Proper citation: RRID:Addgene_28063 Copy
Species: Homo sapiens
Genetic Insert: DUSP7
Vector Backbone Description: Backbone Size:11000; Vector Backbone:pLEX-HA-MYC; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Tetracycline
Proper citation: RRID:Addgene_27976 Copy
Vector Backbone Description: Backbone Marker:Jie Yang Lab; Backbone Size:3300; Vector Backbone:pLIC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21091446
Comments: This plasmid is used for a novel and straightforward ligation-independent cloning (LIC) method based on nicking DNA endonuclease (NiDE).
To construct a NiDE-compatible pLIC vector, LacZ cDNA was amplified from a modified pMD18 construct by PCR using primers Laz-BgiII-F and Laz-EcoR I-R. The β-galactosidase gene lacZ, including restriction endonuclease sites such as BamHI, SalI, PstI, and SphI, was amplified and then digested by BglII and EcoRI. It was then cloned into pRSETb plasmid between BamHI and EcoRI sites to generate the pLIC vector.
See Author's Map and published article for more information.
Proper citation: RRID:Addgene_27989 Copy
Species: Mus musculus
Genetic Insert: 5.2 kB VEGF
Vector Backbone Description: Backbone Size:5598; Vector Backbone:PGL2 Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15582599
Proper citation: RRID:Addgene_27987 Copy
Species: B. Subtilis
Genetic Insert: AT1.03YEMK
Vector Backbone Description: Backbone Size:6866; Vector Backbone:pDRf1GW-ura3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20854260
Comments: AT1.03 is composed of mseCFPdeltaC11, in which 11 C-terminal amino acids were truncated, Bacillus subtilis F0F1 ATP synthase subunit epsilon with
V9T/V42K/F67T/L78T mutations, and cp173-mVenus.
Proper citation: RRID:Addgene_28004 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
