Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pLKO human ULK1 shRNA 8 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27633 | human ULK1 shRNA 8 | Homo sapiens | Ampicillin | PMID:21205641 | human ULK1 shRNA 8 TRC candidate. shRNA oligo sequence - 5'-CCGGACATCGAGAACGTCACCAAGTCTCGAGACTTGGTGACGTTCTCGATGTTTTTT - 3' | Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:05 | 5 | |
|
pQCXIN- myc ULK1 4SA Resource Report Resource Website 1+ mentions |
RRID:Addgene_27628 | mouse myc ULK1 4SA | Mus musculus | Ampicillin | PMID:21205641 | Backbone Marker:Addgene plasmid 17399; Backbone Size:9135; Vector Backbone:pQCXIN Neo dest; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | S467A, S555A, T574A, S637A. Initial M from ULK1 removed. Silent mutation at Arginine 5, which does not affect amino acid sequence. | 2026-08-15 01:13:04 | 1 | |
|
gBeta Cerulean Resource Report Resource Website 1+ mentions |
RRID:Addgene_27810 | mCerulean C1-Gbeta | Kanamycin | PMID:16040744 | Backbone Size:3984; Vector Backbone:pEGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:07 | 1 | |||
|
mEgr2/LZRS Resource Report Resource Website 1+ mentions |
RRID:Addgene_27784 | Egr2 | Mus musculus | Ampicillin | Backbone Marker:A.Q. Bakker; Backbone Size:12443; Vector Backbone:LZRSpBMN-linker-IRES-EGFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:06 | 2 | |||
|
C5A Resource Report Resource Website 1+ mentions |
RRID:Addgene_27799 | Cerulean-5-Amber | Kanamycin | PMID:17040988 | Control for fluorescence lifetime measurements (FLIM) This construct contains Cerulean attached via a 5 amino acid linker to Amber. Amber was generated by mutating Tyrosine 67 in Venus to Cysteine. See supplemental methods section in associated paper for more details on plasmid construction. | Backbone Size:3984; Vector Backbone:pEGFP C1; Vector Types:Mammalian Expression, FRET donor control; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:07 | 1 | ||
|
monomer-HD Resource Report Resource Website 1+ mentions |
RRID:Addgene_27968 | TAL-monomer-HD | Xanthomonas | Kanamycin | PMID:21248753 | Backbone Size:2672; Vector Backbone:pJ201; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:09 | 1 | ||
|
monomer-NI Resource Report Resource Website 1+ mentions |
RRID:Addgene_27966 | TAL-monomer-NI | Xanthomonas | Kanamycin | PMID:21248753 | Backbone Size:2672; Vector Backbone:pJ201; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:09 | 1 | ||
|
monomer-NG Resource Report Resource Website 1+ mentions |
RRID:Addgene_27967 | TAL-monomer-NG | Xanthomonas | Kanamycin | PMID:21248753 | Backbone Size:2672; Vector Backbone:pJ201; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:08 | 1 | ||
|
monomer-NN Resource Report Resource Website 1+ mentions |
RRID:Addgene_27965 | TAL-monomer-NN | Xanthomonas | Kanamycin | PMID:21248753 | Backbone Size:2672; Vector Backbone:pJ201; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:09 | 1 | ||
|
pLenti-EF1a-Backbone(NI) Resource Report Resource Website 1+ mentions |
RRID:Addgene_27962 | TAL-Backbone(NI) | Synthetic | Ampicillin | PMID:21248753 | Backbone Size:9204; Vector Backbone:pLenti; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:09 | 1 | ||
|
TRMPV-Hygro Resource Report Resource Website 1+ mentions |
RRID:Addgene_27996 | TRMPV-Hygro (shLuci-1309) | Ampicillin | PMID:21131983 | Backbone Marker:Clontech; Backbone Size:9339; Vector Backbone:pQCXIX; Vector Types:Mammalian Expression, Retroviral, RNAi, fluorescent reporters; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:09 | 1 | |||
|
TtTMPV-Neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_27993 | TtTMPV-Neo (shRen) | Ampicillin | PMID:21131983 | Backbone Marker:Clontech; Backbone Size:9003; Vector Backbone:pQCXIX (modified); Vector Types:Mammalian Expression, Retroviral, RNAi, Fluorescent reporters; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:09 | 4 | |||
|
TRMPV-ns Resource Report Resource Website 1+ mentions |
RRID:Addgene_27991 | TRMPV-ns (shRen) | Ampicillin | PMID:21131983 | Backbone Marker:Clontech; Backbone Size:7722; Vector Backbone:pQCXIX (modified); Vector Types:Mammalian Expression, Retroviral, RNAi, Fluorescent reporters; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:09 | 1 | |||
|
TRMPV-Neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_27990 | TRMPV-Neo (shRen) | Ampicillin | PMID:21131983 | Backbone Marker:Clontech; Backbone Size:9117; Vector Backbone:pQCXIX (modified); Vector Types:Mammalian Expression, Retroviral, RNAi, Fluorescent reporters; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:08 | 3 | |||
|
pCLR2068 Resource Report Resource Website 1+ mentions |
RRID:Addgene_28062 | FokI endonuclease | Ampicillin | PMID:17603475 | For expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “+” KKR heterodimeric FokI domain. (Doyon et. al,Nat Biotech 2011) in mammalian cells or zebrafish as described by Moore et al., PLoS One 2012 (https://www.ncbi.nlm.nih.gov/pubmed/22655075) and Cade et al., Nucleic Acids Res 2012 (https://www.ncbi.nlm.nih.gov/pubmed/22684503) | Backbone Size:5725; Vector Backbone:pMLM290; Vector Types:Mammalian Expression, Zebrafish expression; Bacterial Resistance:Ampicillin | Contains H537R point mutation in FokI domain, as well as E490K and I538K present in the vector backbone | 2026-08-15 01:13:09 | 1 | |
|
pCLR2070 Resource Report Resource Website 1+ mentions |
RRID:Addgene_28063 | FokI endonuclease | Ampicillin | PMID:17603475 | For expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “-” ELD heterodimeric FokI domain. (Doyon et. al,Nat Biotech 2011) in mammalian cells or zebrafish as described by Moore et al., PLoS One 2012 (https://www.ncbi.nlm.nih.gov/pubmed/22655075) and Cade et al., Nucleic Acids Res 2012 (https://www.ncbi.nlm.nih.gov/pubmed/22684503) | Backbone Size:5725; Vector Backbone:pMLM292; Vector Types:Mammalian Expression, Zebrafish expression; Bacterial Resistance:Ampicillin | Contains N496D point mutation in FokI domain, as well as Q486E and I499L present in the vector backbone | 2026-08-15 01:13:10 | 1 | |
|
DUSP7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27976 | DUSP7 | Homo sapiens | Tetracycline | Backbone Size:11000; Vector Backbone:pLEX-HA-MYC; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Tetracycline | 2026-08-15 01:13:08 | 1 | |||
|
pLIC Resource Report Resource Website 1+ mentions |
RRID:Addgene_27989 | Ampicillin | PMID:21091446 | This plasmid is used for a novel and straightforward ligation-independent cloning (LIC) method based on nicking DNA endonuclease (NiDE). To construct a NiDE-compatible pLIC vector, LacZ cDNA was amplified from a modified pMD18 construct by PCR using primers Laz-BgiII-F and Laz-EcoR I-R. The β-galactosidase gene lacZ, including restriction endonuclease sites such as BamHI, SalI, PstI, and SphI, was amplified and then digested by BglII and EcoRI. It was then cloned into pRSETb plasmid between BamHI and EcoRI sites to generate the pLIC vector. See Author's Map and published article for more information. | Backbone Marker:Jie Yang Lab; Backbone Size:3300; Vector Backbone:pLIC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:09 | 1 | |||
|
5.2 kB VEGF-luc Resource Report Resource Website 1+ mentions |
RRID:Addgene_27987 | 5.2 kB VEGF | Mus musculus | Ampicillin | PMID:15582599 | Backbone Size:5598; Vector Backbone:PGL2 Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:08 | 1 | ||
|
pDR-GW AT1.03YEMK Resource Report Resource Website 1+ mentions |
RRID:Addgene_28004 | AT1.03YEMK | B. Subtilis | Ampicillin | PMID:20854260 | AT1.03 is composed of mseCFPdeltaC11, in which 11 C-terminal amino acids were truncated, Bacillus subtilis F0F1 ATP synthase subunit epsilon with V9T/V42K/F67T/L78T mutations, and cp173-mVenus. | Backbone Size:6866; Vector Backbone:pDRf1GW-ura3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | M60Y, G131E, K132M, 133K | 2026-08-15 01:13:09 | 8 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
