Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: CtlP
Vector Backbone Description: Backbone Marker:David Root; Addgene plasmid #41393; Vector Backbone:pCW57.1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26649820
Comments: siRNA resistant construct. Custom CtlP siRNA (Dharmacon) sequence: GCUAAAACAGGAACGAAUC
Proper citation: RRID:Addgene_71111 Copy
Species: Homo sapiens
Genetic Insert: BRCA1
Vector Backbone Description: Vector Backbone:pDEST-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26649820
Comments: siRNA resistant sequence: CAGCTACCCTagtATaATc
The BRCA1 insert contains the following mutations (residue numbering relative to the plasmid's open reading frame): P1565L, E1732G, A1836T, K1877R, and S2307G
Proper citation: RRID:Addgene_71116 Copy
Species: Homo sapiens
Genetic Insert: BRCA1
Vector Backbone Description: Vector Backbone:pDEST-Flag ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26649820
Comments: siRNA resistant sequence: CAGCTACCCTagtATaATc
The BRCA1 insert contains the following mutations (residue numbering relative to the plasmid's open reading frame): P1565L, E1732G, A1836T, K1877R, and S2307G
Proper citation: RRID:Addgene_71117 Copy
Species: Homo sapiens
Genetic Insert: Sequestosome-1
Vector Backbone Description: Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22777351
Comments: This plasmid contains a T375A mutation within the Sequestosome-1 translation compared to NP_003891.1. The depositor states that this mutation does not affect plasmid function.
Proper citation: RRID:Addgene_71305 Copy
Species: Homo sapiens
Genetic Insert: Sequestosome-1
Vector Backbone Description: Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22777351
Comments: This plasmid contains a T375A mutation within the Sequestosome-1 translation compared to NP_003891.1. The depositor states that this mutation should not affect plasmid function.
Proper citation: RRID:Addgene_71306 Copy
Species: Homo sapiens
Genetic Insert: H-RAS-V12
Vector Backbone Description: Backbone Size:5300; Vector Backbone:pBABE-neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21119005
Comments: The insert within this plasmid contains a E143K mutation compared to NP_005334.1. The depositor states that this mutation should not affect plasmid function.
The HRAS coding sequence may have been codon optimized and differs from the NCBI reference sequences for this gene. Primer design and applications involving the use of the HRAS coding sequence should be based off of the Addgene NGS Result for accuracy
Proper citation: RRID:Addgene_71304 Copy
Species: Homo sapiens
Genetic Insert: DDX5/17 shRNA
Vector Backbone Description: Backbone Marker:GE - Dharmacon; Backbone Size:13362; Vector Backbone:pTRIPZ; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26209609
Proper citation: RRID:Addgene_71307 Copy
Species: Homo sapiens
Genetic Insert: STIMATE (1-240)
Vector Backbone Description: Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26322679
Proper citation: RRID:Addgene_71280 Copy
Species: Homo sapiens
Genetic Insert: Lamp2b
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5578; Vector Backbone:pcDNA 3.1+ Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25657008
Proper citation: RRID:Addgene_71294 Copy
Species: Homo sapiens
Genetic Insert: human synapsin promoter-flex switch-dsRed-shscramble
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pUC; Vector Types:Mammalian Expression, AAV, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26094607
Comments: this plasmid is modified from the pRIME system. See:
Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A
lentiviral microRNA-based system for single-copy polymerase II-regulated
RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102,
13212–13217
We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664), as the building block to make the AAV-hsyn-flex-dsRed-shscramble plasmid
All the enzymes are unique cutters, except EcoRI and XhoI, the insert dsRed-shRNA can be retrieved using AscI and NheI, giving 1.2kb and 4.8kb bands.
The insert was read using primers in the dsred sequence:
dsred 410: CGTAATGCAGAAGAAGACTATG
dsred 530R: CCATGTAGATGGACTTGAACTC
Proper citation: RRID:Addgene_71383 Copy
Species: Homo sapiens
Genetic Insert: MLL-AF9
Vector Backbone Description: Backbone Size:6600; Vector Backbone:pMIRL; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26440282
Proper citation: RRID:Addgene_71444 Copy
Species: Homo sapiens
Genetic Insert: MLL-Af9
Vector Backbone Description: Backbone Size:6600; Vector Backbone:pMIGL; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26440282
Proper citation: RRID:Addgene_71443 Copy
Species: Homo sapiens
Genetic Insert: STAT3
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pLEGFP-N1-neo; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25767098
Proper citation: RRID:Addgene_71449 Copy
Species: Homo sapiens
Genetic Insert: STAT3
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pLEGFP-N1-neo; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25767098
Proper citation: RRID:Addgene_71447 Copy
Species: Homo sapiens
Genetic Insert: TERT
Vector Backbone Description: Backbone Size:2000; Vector Backbone:pUC57; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26553065
Proper citation: RRID:Addgene_71398 Copy
Species: Homo sapiens
Genetic Insert: SUMO1/sentrin specific peptidase 3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5329; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26522917
Proper citation: RRID:Addgene_71467 Copy
Species: Homo sapiens
Genetic Insert: SUMO1/sentrin specific peptidase 5
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5289; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26522917
Comments: Insert gene optimisation performed by Genscript
Proper citation: RRID:Addgene_71468 Copy
Species: Homo sapiens
Genetic Insert: SUMO1/sentrin specific peptidase 6
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5289; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26522917
Comments: Insert gene optimisation performed by Genscript
Proper citation: RRID:Addgene_71469 Copy
Species: Homo sapiens
Genetic Insert: STAT1
Vector Backbone Description: Backbone Marker:Andrei Gudkov lab; Vector Backbone:pLV-tetO-CMV-SV40-puro-LoxP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19478064
Proper citation: RRID:Addgene_71453 Copy
Species: Homo sapiens
Genetic Insert: HDAC4 1-129
Vector Backbone Description: Backbone Marker:Addgene plasmid #11160; Backbone Size:4798; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26272629
Proper citation: RRID:Addgene_71401 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
