Plasmids   Select Another Resource Report Type

http://www.addgene.org/61918

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21925267
Comments: Genotype = cyo ilvE avtA aspC hisG argH metA Precursor strain = ML26 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Arg, Met *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61918 Copy   

•   Source: Addgene

http://www.addgene.org/61914

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21925267
Comments: Genotype = tyrA hisG Precursor strain = ML14 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Tyr), His Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61914 Copy   

•   Source: Addgene

http://www.addgene.org/61922

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21925267
Comments: Genotype = cyo ilvE avtA aspC hisG argH metA lysA thrC asnA asnB Precursor strain = ML42 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Arg, Met, Lys, Thr, Asn *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61922 Copy   

•   Source: Addgene

http://www.addgene.org/61953

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26577727
Comments: Genotype = cysE Precursor strain = C43(DE3) Selective amino acid labeling (and/or requirement) = Cys Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_61953 Copy   

•   Source: Addgene

http://www.addgene.org/61960

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26577727
Comments: Genotype = cysE hisG Precursor strain = YM138 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = Cys, His Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_61960 Copy   

•   Source: Addgene

http://www.addgene.org/61962

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26577727
Comments: Genotype = glyA Precursor strain = BL21 CodonPlus (DE3)-RIL Selective amino acid labeling (and/or requirement) = Gly Each target gene was deleted from the chromosome of BL21 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_61962 Copy   

•   Source: Addgene

http://www.addgene.org/62072

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26577727
Comments: Genotype = aspC tyrB Precursor strain = RF3 modified from the parent Escherichia coli BL21 CodonPlus (DE3)-RIL Selective amino acid labeling (and/or requirement) = Asp++++, Tyr, (Phe) ++++RF4, RF5, and RF13 strains have knockouts in both aspC and tyrB genes and therefore require the presence of L-Asp (but not L-Glu) for growth in M63 minimal medium. These strains can be used for selective labeling of selected aromatic amino acid(s) such as Tyr (RF4, RF5, RF13) and/or Trp (RF13). We have NOT tested if these strains could also be used for selective Asp labeling studies (under investigation). Each target gene was deleted from the chromosome of BL21 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_62072 Copy   

•   Source: Addgene

http://www.addgene.org/62078

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26577727
Comments: Genotype = aspC tyrB trpA trpB Precursor strain = RF4 modified from the parent Escherichia coli BL21 CodonPlus (DE3)-RIL Selective amino acid labeling (and/or requirement) = Asp++++, Tyr, Trp, (Phe) ++++RF4, RF5, and RF13 strains have knockouts in both aspC and tyrB genes and therefore require the presence of L-Asp (but not L-Glu) for growth in M63 minimal medium. These strains can be used for selective labeling of selected aromatic amino acid(s) such as Tyr (RF4, RF5, RF13) and/or Trp (RF13). We have NOT tested if these strains could also be used for selective Asp labeling studies (under investigation). Each target gene was deleted from the chromosome of BL21 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_62078 Copy   

•   Source: Addgene

http://www.addgene.org/62074

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26577727
Comments: Genotype = proC Precursor strain = BL21 CodonPlus (DE3)-RIL Selective amino acid labeling (and/or requirement) = Pro Each target gene was deleted from the chromosome of BL21 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_62074 Copy   

•   Source: Addgene

http://www.addgene.org/62075

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26577727
Comments: Genotype = asnA asnB Precursor strain = BL21 CodonPlus (DE3)-RIL Selective amino acid labeling (and/or requirement) = Asn Each target gene was deleted from the chromosome of BL21 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_62075 Copy   

•   Source: Addgene

http://www.addgene.org/62820

Genetic Insert: see comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:26261213
Comments: MG1655 + lacIq intergrated at intS + ΔglmZ + Dhfq

Proper citation: RRID:Addgene_62820 Copy   

•   Source: Addgene

http://www.addgene.org/191530

Species: E.coli
Genetic Insert: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:34949838
Comments: Derived from BL21(AI), grow in LB in BSL1 laboratory conditions Genotype: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1 Genotyping primers: CATGTGCATGAAAACCACTGC / CTGGTTGGACGAAGAAGTGC (273 base amplicon)

Proper citation: RRID:Addgene_191530 Copy   

•   Source: Addgene

http://www.addgene.org/132780

Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:33536221
Comments: Genotype: W3110 ∆waaL ∆lpxM

Proper citation: RRID:Addgene_132780 Copy   

•   Source: Addgene

http://www.addgene.org/192874

Species: E.coli
Genetic Insert: The strain has a 535 nt deletion between nt 15 and nt 551 in the EntD gene.
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:16709676
Comments: EntD, a 4'-phosphopantetheinyl transferase, is required for native enterobactin synthesis. This strain allows for expression of nonribosomal peptide synthetase (NRPS) carrier proteins that do not harbor a phosphopantetheinyl group.

Proper citation: RRID:Addgene_192874 Copy   

•   Source: Addgene

http://www.addgene.org/197933

Genetic Insert: RNA polymerase gene (T7 phage)/chromosome
Vector Backbone Description: Vector Backbone:BL21(DE3); Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:25982672
Comments: Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons and disruption of the prfA gene

Proper citation: RRID:Addgene_197933 Copy   

•   Source: Addgene

http://www.addgene.org/72402

Vector Backbone Description: Vector Backbone:E. coli BW25113; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:26315440
Comments: No antibiotic resistance.

Proper citation: RRID:Addgene_72402 Copy   

•   Source: Addgene

http://www.addgene.org/60376

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:21189298
Comments: MG1655 + lacIq intergrated at intS + Δ hfq + Δ ryhB

Proper citation: RRID:Addgene_60376 Copy   

•   Source: Addgene

http://www.addgene.org/60371

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:21189298
Comments: MG1655 + lacIq intergrated at intS + Δ dsrA

Proper citation: RRID:Addgene_60371 Copy   

•   Source: Addgene

http://www.addgene.org/60370

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:21189298
Comments: MG1655 + lacIq intergrated at intS + Δ micC

Proper citation: RRID:Addgene_60370 Copy   

•   Source: Addgene

http://www.addgene.org/60374

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:21189298
Comments: MG1655 + lacIq intergrated at intS + Δ ryhB

Proper citation: RRID:Addgene_60374 Copy   

•   Source: Addgene