Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
JM106 Resource Report Resource Website |
RRID:Addgene_49757 | Relevant genotype: endA1, gyrA96, thi, hsdR17, supE44, relA1, λ-, Δ(lac-proAB) | E.coli | None | PMID:2985470 | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:16:02 | 0 | ||
|
JM101 Resource Report Resource Website |
RRID:Addgene_50349 | Relevant genotype: supE, thi, Δ(lac-proAB), [F' traD36, proAB, lacIqZΔM15] | E. coli | None | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:16:05 | 0 | |||
|
JM83 Resource Report Resource Website |
RRID:Addgene_50348 | Relevant genotype: ara, Δ(lac-proAB), rspL(+strA), ϕ80, lacZΔM15 | E. coli | None | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:16:07 | 0 | |||
|
MG1655 ΔendA ΔrecA Resource Report Resource Website |
RRID:Addgene_37853 | None | PMID:20643967 | Vector Backbone:N/A; Vector Types:E. coli bacterial strain; Bacterial Resistance:None | 2026-08-15 01:14:17 | 0 | ||||
|
MG1655 ΔendA ΔrecA (DE3) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37854 | None | PMID:21110891 | Vector Backbone:N/A; Vector Types:E. coli bacterial strain; Bacterial Resistance:None | 2026-08-15 01:14:17 | 8 | ||||
|
BL21∆serB Resource Report Resource Website 1+ mentions |
RRID:Addgene_34929 | None | PMID:21868676 | To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain BL21. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy. | Vector Backbone:None; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:13:56 | 5 | |||
|
JS200 strain Resource Report Resource Website |
RRID:Addgene_11794 | JS200 | None | PMID:12909725 | For use with pEP PolI (addgene #11722) and pWT PolI (addgene #11721). This strain contains a temp sens mutation in PolI. | Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:02:59 | 0 | ||
|
BLIM cells Resource Report Resource Website 1+ mentions |
RRID:Addgene_35609 | none | None | PMID:10610690 | To be used with the following plasmids from the Matthews lab: pTARA (www.addgene.org/31491), pLS1 (www.addgene.org/31490), and (www.addgene.org/31492) pLS1/-11 | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:14:02 | 1 | ||
|
BL21 ΔrecBCD Resource Report Resource Website |
RRID:Addgene_176581 | This is a strain. | None | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None | recBCD genomic deletion | 2026-08-15 01:11:00 | 0 | |
|
BL21ΔABC Resource Report Resource Website |
RRID:Addgene_102266 | None | PMID:29164072 | Genotype = ΔompA ΔlamB ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:00:23 | 0 | |||
|
BL21ΔABF Resource Report Resource Website |
RRID:Addgene_102267 | None | PMID:29164072 | Genotype = ΔompA ΔlamB ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:00:23 | 0 | |||
|
RF15 Resource Report Resource Website |
RRID:Addgene_102799 | none | None | PMID:33289521 | This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB trpA trpB glyA serB Precursor strain = RF14 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Trp, (Phe), Gly, Ser+++++ +++++ RF15 has knockouts in aspC, tyrB, trpA, trpB, glyA and serB genes and requires the presence of L-Asp, L-Tyr, L-Trp, L-Gly plus L-Ser for growth in M63 minimal medium, but it does NOT grow in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser plus L-Cys (either in the presence or absence of L-Ala) (i.e., L-Cys inhibits the growth of RF15) Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:00:26 | 0 | ||
|
RF21 Resource Report Resource Website |
RRID:Addgene_102803 | none | None | PMID:33289521 | This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB ilvE avtA yfbQ(alaA) yfdZ(alaC) Precursor strain = RF18 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Phe, Ile, Leu, Val#### #### RF21 has knockouts in the four general transaminase genes of E. coli (aspC, tyrB, ilvE, and avtA) and is found to require the presence of L-Asp, L-Tyr, L-Phe, L-Ile, L-Leu plus L-Val for slow growth in M63 minimal medium. Although RF21 strain has further knockouts in yfbQ (alaA) and yfdZ (alaC) genes, it is NOT an L-Ala auxotroph, either (requiring the presence of L-Asp, L-Tyr, L-Phe, L-Ile, L-Leu plus L-Val for slow growth in M63 minimal medium, like RF18). Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:00:26 | 0 | ||
|
RF18 Resource Report Resource Website |
RRID:Addgene_102802 | none | None | PMID:33289521 | This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB ilvE avtA Precursor strain = RF17 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Phe, Ile, Leu, Val#### ####RF18 has knockouts in the four general transaminase genes of E. coli (aspC, tyrB, ilvE, and avtA) and is found to require the presence of L-Asp, L-Tyr, L-Phe, L-Ile, L-Leu plus L-Val for slow growth in M63 minimal medium. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:00:26 | 0 | ||
|
HL 6703 Resource Report Resource Website |
RRID:Addgene_69778 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:18:55 | 0 | ||||
|
HL 6686 Resource Report Resource Website |
RRID:Addgene_69775 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:18:55 | 0 | ||||
|
HL 3500 Resource Report Resource Website |
RRID:Addgene_69774 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:18:55 | 0 | ||||
|
HL 6778 Resource Report Resource Website |
RRID:Addgene_69782 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:19:01 | 0 | ||||
|
HL 6777 Resource Report Resource Website |
RRID:Addgene_69781 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:18:55 | 0 | ||||
|
CY027 Resource Report Resource Website |
RRID:Addgene_72402 | None | PMID:26315440 | No antibiotic resistance. | Vector Backbone:E. coli BW25113; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:19:19 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
