Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:rattus norvegicus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,184 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pN1-RnKIF5C(1-560)-Halo-Flag
 
Resource Report
Resource Website 		RRID:Addgene_188071 rat KIF5C Rattus norvegicus Kanamycin PMID:35504282 Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin aa1-560 Addgene 2026-09-26 02:42:03 0
pN1-RnKIF5C(1-560,Δ6)-Halo-Flag
 
Resource Report
Resource Website 		RRID:Addgene_188072 rat KIF5C Rattus norvegicus Kanamycin PMID:35504282 Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin aa1-560, deletion of aa2-6 Addgene 2026-09-26 02:42:03 0
EGFP-Myo1b
 
Resource Report
Resource Website 		RRID:Addgene_187362 myosin 1b isoform b Rattus norvegicus Kanamycin PMID:10233157 The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between GFP and Myo1b. Backbone Marker:Clontech; Backbone Size:4752; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-09-26 02:42:06 0
Cherry-Myo1b
 
Resource Report
Resource Website 		RRID:Addgene_187366 myosin 1b isoform b Rattus norvegicus Kanamycin PMID:29588377 The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between Cherry and Myo1b. Backbone Marker:Clontech; Backbone Size:4743; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-09-26 02:42:06 0
EGFP-Myo1b-Tail
 
Resource Report
Resource Website 		RRID:Addgene_187365 myosin 1b isoform b Tail domain Rattus norvegicus Kanamycin PMID:26195670 PCR cloning at BglII-SalI DNA fragment was generated by PCR on rat Myo1b cDNA with 5' primer TTGGCCATCAAGACCTTACCTA and 3' primer CCTCACTTAAGGGACAGCGACTT Backbone Marker:Clontech; Backbone Size:4713; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-09-26 02:42:06 0
EGFP-Myo1-IQ-Tail
 
Resource Report
Resource Website 		RRID:Addgene_187363 myosin 1b isoform b IQTail domain Rattus norvegicus Kanamycin PMID:10233157 The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between GFP and Myo1b. Cloning by deletion of the fragment EcoRV-EcoRV from the recombinant plasmid encoding GFP-Myo1b. Backbone Marker:Clontech; Backbone Size:4743; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-09-26 02:42:06 0
Stx3
 
Resource Report
Resource Website 		RRID:Addgene_186685 Syntaxin 3 Rattus norvegicus Ampicillin PMID:35322233 Vector Backbone:pTEV5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-09-26 02:42:07 0
MOR BRET sensor
 
Resource Report
Resource Website 		RRID:Addgene_231810 µ-Opioid Receptor Rattus norvegicus Ampicillin PMID:39920410 Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-09-26 02:53:44 0
pOTTC2360 - pAAV rActin EGFP donor
 
Resource Report
Resource Website 		RRID:Addgene_228444 mEGFP Rattus norvegicus Ampicillin PMID:41428486 Vector Backbone:Addgene #119870; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin Addgene 2026-09-26 02:53:50 0
pSB-CMV-MCS-Puro-ArfGAP1_ALPS1-mKate2-3NLS-P2A-eGFP-LMNB1
 
Resource Report
Resource Website 		RRID:Addgene_250914 ArfGAP1-mKate2-3xNLS-P2A-EGFP-LMNB1 Rattus norvegicus Ampicillin PMID:41366519 Backbone Size:5662; Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin ARFGAP1 amino acids 196–234 only Addgene 2026-09-26 02:53:57 0
pGEX4T3-Stx3-L77A/L80A
 
Resource Report
Resource Website 		RRID:Addgene_100273 Stx3-1-265-L77A/L80A Rattus norvegicus Ampicillin PMID:33288783 Backbone Marker:GE Lifesciences; Backbone Size:4968; Vector Backbone:pGEX4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin No transmembrane domain; residues 4-264 present, changed both L77 and L80 to alanines Addgene 2026-09-26 02:18:16 0
pGEX4T3-Stx3-E78A/E83A
 
Resource Report
Resource Website 		RRID:Addgene_100272 Stx3-1-265-E78A/E83A Rattus norvegicus Ampicillin PMID:33288783 Backbone Marker:GE Lifesciences; Backbone Size:4968; Vector Backbone:pGEX4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin No transmembrane domain; residues 4-264 present, changed both E78 and E83 to alanines Addgene 2026-09-26 02:18:16 0
pRK5-FLAG-S6K1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100509 S6K1 Rattus norvegicus Ampicillin PMID:29123071 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-09-26 02:18:17 3
SaBE4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100805 SaBE4 Rattus norvegicus Ampicillin PMID:28875174 Backbone Size:3402; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-09-26 02:18:20 1
BE4-Gam
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_100806 BE4-Gam Rattus norvegicus Ampicillin PMID:28875174 Backbone Size:3402; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-09-26 02:18:20 20
BE3-Gam
 
Resource Report
Resource Website 		RRID:Addgene_100807 BE3-Gam Rattus norvegicus Ampicillin PMID:28875174 Backbone Size:3402; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-09-26 02:18:20 0
BE4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100802 BE Rattus norvegicus Ampicillin PMID:28875174 Backbone Size:3402; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-09-26 02:18:20 8
pFlg240
 
Resource Report
Resource Website 		RRID:Addgene_101018 GluR 1 Rattus norvegicus Ampicillin PMID:16765522 Backbone Marker:life technologies; Backbone Size:4500; Vector Backbone:CMV sport; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin fluorescent protein inserted into subunit Addgene 2026-09-26 02:18:21 0
pFlg167
 
Resource Report
Resource Website 		RRID:Addgene_101019 GluR 1 Rattus norvegicus Ampicillin PMID:16765522 Backbone Marker:life technologies; Backbone Size:4500; Vector Backbone:CMV sport; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin fluorescent protein inserted into subunit Addgene 2026-09-26 02:18:21 0
pFlg262
 
Resource Report
Resource Website 		RRID:Addgene_101016 GluR 1 Rattus norvegicus Ampicillin PMID:16765522 Backbone Marker:life technologies; Backbone Size:4500; Vector Backbone:CMV sport; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin fluorescent protein inserted into subunit Addgene 2026-09-26 02:18:21 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch