Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Gallus gallus
Genetic Insert: Fibroblast growth factor receptor 3 isoform 1
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18602913
Comments: Probe 2_81
Proper citation: RRID:Addgene_19230 Copy
Species: Gallus gallus
Genetic Insert: Cellular retinoic acid binding protein 2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18602913
Comments: Probe 1_11
Proper citation: RRID:Addgene_19188 Copy
Species: Gallus gallus
Genetic Insert: Tyr3/Trp5 monooxygenase
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18602913
Comments: Probe 2_73
Proper citation: RRID:Addgene_19226 Copy
Species: Gallus gallus
Genetic Insert: Tenomodulin
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18602913
Comments: Probe 1_72, expression in the PO and in the outer PC layer.
Proper citation: RRID:Addgene_19200 Copy
Species: Gallus gallus
Genetic Insert: NFATC1
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18602913
Comments: Probe 1_81, expression pattern is similar to tenomodulin or ColXIV or CRABP1.
Proper citation: RRID:Addgene_19203 Copy
Species: Gallus gallus
Genetic Insert: ADAM metallopeptidase with thrombospondin type 1
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18602913
Comments: Probe 1_85, expressed in the inner layer of PO.
Proper citation: RRID:Addgene_19205 Copy
Species: Gallus gallus
Genetic Insert: Alpha 2 type I collagen
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18602913
Comments: Probe 1_96, expressed in early osteoblasts.
Proper citation: RRID:Addgene_19207 Copy
Species: Gallus gallus
Genetic Insert: DnaJA3
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18602913
Comments: Probe 1_88, expressed in part of PC in the inner layer and PO.
Proper citation: RRID:Addgene_19206 Copy
Species: Gallus gallus
Genetic Insert: c-Src
Vector Backbone Description: Backbone Marker:Addgene Plasmid 1765; Backbone Size:5558; Vector Backbone:pBABE-hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19573813
Comments: Dasatinib resistant mutant.
GenBank: V00402.1
Proper citation: RRID:Addgene_26980 Copy
Species: Gallus gallus
Genetic Insert: Vinculin
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20613844
Proper citation: RRID:Addgene_27300 Copy
Species: Gallus gallus
Genetic Insert: c-src
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2582237
Comments: pMcsrc was constructed by gel purifying the 8.1-kilobase (kb) BamHI c-src fragment running from c-src coordinates -2.1 to 6.0 kb and ligating it into plasmid pEVX which had been linearized at a unique BglII site lying between the two Moloney murine leukemia virus (MoMLV) long terminal
repeats (LTRs). The upstream BamHI site is about 270 base
pairs (bp) upstream from the beginning of c-src exon no. 2, whereas the downstream site lies about 1.2 kb beyond the c-src termination codon.
Proper citation: RRID:Addgene_17672 Copy
Species: Gallus gallus
Genetic Insert: c-src
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3103925
Comments: The plasmid contains a c-src gene that encodes normal chicken pp60 c-src flanked by MoMLV LTRs from expression vector pEVX.
Proper citation: RRID:Addgene_17674 Copy
Species: Gallus gallus
Genetic Insert: c-src Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3103925
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17675 Copy
Species: Gallus gallus
Genetic Insert: c-src Y416F Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3103925
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17677 Copy
Species: Gallus gallus
Genetic Insert: c-src S17A
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2474754
Comments: pcAlal7 was constructed by inserting the synthetic double-stranded DNA oligomer GATCCCAGCCAGCGCCGGCGGGCCCGGTCGGTCGCGGCCGCCCGGGA between the BamHI (codon 10) and BstNI (codon 18) sites of pcAlal2.
Proper citation: RRID:Addgene_17681 Copy
Species: Gallus gallus
Genetic Insert: Src
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11684709
Proper citation: RRID:Addgene_19965 Copy
Species: Gallus gallus
Genetic Insert: ASIC1
Vector Backbone Description: Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39182166
Proper citation: RRID:Addgene_233130 Copy
Species: Gallus gallus
Genetic Insert: ASIC1
Vector Backbone Description: Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39182166
Proper citation: RRID:Addgene_233131 Copy
Species: Gallus gallus
Genetic Insert: ASIC1
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39182166
Proper citation: RRID:Addgene_233133 Copy
Species: Gallus gallus
Genetic Insert: Opn5
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35579776
Proper citation: RRID:Addgene_237859 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
