Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:gallus gallus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

644 Results - per page

Show More Columns | Download 644 Result(s)

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pBS FGF3 isoform 1
 
Resource Report
Resource Website 		RRID:Addgene_19230 Fibroblast growth factor receptor 3 isoform 1 Gallus gallus Ampicillin PMID:18602913 Probe 2_81 Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:43 0
pBS CRABP2
 
Resource Report
Resource Website 		RRID:Addgene_19188 Cellular retinoic acid binding protein 2 Gallus gallus Ampicillin PMID:18602913 Probe 1_11 Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:42 0
pBS 14-3-3 zeta
 
Resource Report
Resource Website 		RRID:Addgene_19226 Tyr3/Trp5 monooxygenase Gallus gallus Ampicillin PMID:18602913 Probe 2_73 Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:43 0
pBS Tenomodulin
 
Resource Report
Resource Website 		RRID:Addgene_19200 Tenomodulin Gallus gallus Ampicillin PMID:18602913 Probe 1_72, expression in the PO and in the outer PC layer. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:43 0
pBS NFATC1
 
Resource Report
Resource Website 		RRID:Addgene_19203 NFATC1 Gallus gallus Ampicillin PMID:18602913 Probe 1_81, expression pattern is similar to tenomodulin or ColXIV or CRABP1. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:43 0
pBS ADAMTS3
 
Resource Report
Resource Website 		RRID:Addgene_19205 ADAM metallopeptidase with thrombospondin type 1 Gallus gallus Ampicillin PMID:18602913 Probe 1_85, expressed in the inner layer of PO. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:43 0
pBS ColI alpha2
 
Resource Report
Resource Website 		RRID:Addgene_19207 Alpha 2 type I collagen Gallus gallus Ampicillin PMID:18602913 Probe 1_96, expressed in early osteoblasts. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:43 0
pBS DNAJ3
 
Resource Report
Resource Website 		RRID:Addgene_19206 DnaJA3 Gallus gallus Ampicillin PMID:18602913 Probe 1_88, expressed in part of PC in the inner layer and PO. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:43 0
pBABE-Src-Dasatinib-resistant
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26980 c-Src Gallus gallus Ampicillin PMID:19573813 Dasatinib resistant mutant. GenBank: V00402.1 Backbone Marker:Addgene Plasmid 1765; Backbone Size:5558; Vector Backbone:pBABE-hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin T338I 2026-08-15 01:12:58 6
Vinculin-venus
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_27300 Vinculin Gallus gallus Ampicillin PMID:20613844 Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:02 8
pMcSrc
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_17672 c-src Gallus gallus Ampicillin PMID:2582237 pMcsrc was constructed by gel purifying the 8.1-kilobase (kb) BamHI c-src fragment running from c-src coordinates -2.1 to 6.0 kb and ligating it into plasmid pEVX which had been linearized at a unique BglII site lying between the two Moloney murine leukemia virus (MoMLV) long terminal repeats (LTRs). The upstream BamHI site is about 270 base pairs (bp) upstream from the beginning of c-src exon no. 2, whereas the downstream site lies about 1.2 kb beyond the c-src termination codon. Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:01 1
pM5HHB5
 
Resource Report
Resource Website 		RRID:Addgene_17674 c-src Gallus gallus Ampicillin PMID:3103925 The plasmid contains a c-src gene that encodes normal chicken pp60 c-src flanked by MoMLV LTRs from expression vector pEVX. Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:01 0
pcSrc527
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_17675 c-src Y527F Gallus gallus Ampicillin PMID:3103925 Based on plasmid pM5HHB5. Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Tyr 527 changed to Phe . Activates transforming and kinase activities. 2026-08-15 01:11:01 5
pcSrc416/527
 
Resource Report
Resource Website 		RRID:Addgene_17677 c-src Y416F Y527F Gallus gallus Ampicillin PMID:3103925 Based on plasmid pM5HHB5. Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Tyr 416 changed to Phe . Tyr 527 changed to Phe . 2026-08-15 01:11:02 0
pcAla17
 
Resource Report
Resource Website 		RRID:Addgene_17681 c-src S17A Gallus gallus Ampicillin PMID:2474754 pcAlal7 was constructed by inserting the synthetic double-stranded DNA oligomer GATCCCAGCCAGCGCCGGCGGGCCCGGTCGGTCGCGGCCGCCCGGGA between the BamHI (codon 10) and BstNI (codon 18) sites of pcAlal2. Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Ser 17 changed to Ala. 2026-08-15 01:11:02 0
pRK5 DN-Src
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19965 Src Gallus gallus Ampicillin PMID:11684709 Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin K295M 2026-08-15 01:11:50 1
cASIC1 concatemer - Subunit B
 
Resource Report
Resource Website 		RRID:Addgene_233130 ASIC1 Gallus gallus Kanamycin PMID:39182166 Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:32:28 0
cASIC1 concatemer - Subunit C
 
Resource Report
Resource Website 		RRID:Addgene_233131 ASIC1 Gallus gallus Kanamycin PMID:39182166 Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:32:26 0
cASIC1 concatemer - fully assembled
 
Resource Report
Resource Website 		RRID:Addgene_233133 ASIC1 Gallus gallus Ampicillin PMID:39182166 Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:32:26 0
pAAV-GfaABC1D-cOpn5-T2A-EGFP
 
Resource Report
Resource Website 		RRID:Addgene_237859 Opn5 Gallus gallus Ampicillin PMID:35579776 Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:33:45 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch