Plasmids   Select Another Resource Report Type

http://www.addgene.org/28244

Species: Arabidopsis thaliana
Genetic Insert: cry2
Vector Backbone Description: Backbone Size:7480; Vector Backbone:na; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21037589

Proper citation: RRID:Addgene_28244 Copy   

•   Source: Addgene

http://www.addgene.org/29042

Species: Homo sapiens
Genetic Insert: Ple51
Vector Backbone Description: Backbone Size:17451; Vector Backbone:pEMS1302; Vector Types:Pleiades Promoter Project [sic, Pleaides Plieades]; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20807748

Proper citation: RRID:Addgene_29042 Copy   

•   Source: Addgene

http://www.addgene.org/21835

Species: Mus musculus
Genetic Insert: GADD34
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11381086
Comments: The construct was created by recovering the Sma1 fragment of mMyD116 and ligating it into the unique SnB1 site of pBABEpu. The stop codo is deep in the downstream SV40 promoter sequence andowing the encoded poly-peptide with a tail of nonesense sequence, but it does serve as an expressed negative control for the effects of GADD34.

Proper citation: RRID:Addgene_21835 Copy   

•   Source: Addgene

http://www.addgene.org/21842

Species: L. pneumophila
Genetic Insert: fabI
Vector Backbone Description: Backbone Size:9869; Vector Backbone:pXDC61; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:19578436

Proper citation: RRID:Addgene_21842 Copy   

•   Source: Addgene

http://www.addgene.org/21813

Species: Cricetulus longicaudatus (long-tailed hamster)
Genetic Insert: GADD34 C-term
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11381086
Comments: Hamster GADD34 C-term was isolated in a somatic cell genetic screen as a high dose supressor of the intergated stess response. The insert from the retrovirus isolated in that screen was recloned into unique BamH1 and Sal1 sites of pBABEpu and confirmed to suppress the ISR when introduced back into cells.

Proper citation: RRID:Addgene_21813 Copy   

•   Source: Addgene

http://www.addgene.org/21812

Species: Homo sapiens
Genetic Insert: pQE-nTR
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:4700; Vector Backbone:pQE-80L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15226295

Proper citation: RRID:Addgene_21812 Copy   

•   Source: Addgene

http://www.addgene.org/21817

Species: Mus musculus
Genetic Insert: PERK (537-1114)
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9930704
Comments: Mouse PERK (537-1114), wild-type, 9E10-tagged at C-terminus, fused to GST, bacterial expression vector, pGEX4T-1 Sequencing found a S1109T mutation. There is no evidence that the mutation affects activity.

Proper citation: RRID:Addgene_21817 Copy   

•   Source: Addgene

http://www.addgene.org/21826

Species: simian virus
Genetic Insert: SV40 Large T
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Bluescribe; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: SV40 large T antigen for immortalizing cells. See Author's Map for more information. Please note that this plasmid likely expreses a truncated SV40 large T antigen protein starting with the methionine at amino acid 109, when compared to GenBank reference sequence YP_003708382.1 (see NC_001669.1 for the corresponding nucleotide sequence). The plasmid functions as described to immortalize MEFs.

Proper citation: RRID:Addgene_21826 Copy   

•   Source: Addgene

http://www.addgene.org/21871

Vector Backbone Description: Backbone Size:3508; Vector Backbone:pMLM36; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19798082
Comments: Combinatorial libraries of zinc finger arrays made by OPEN are cloned into this plasmid (see Maeder et al., Mol Cel 2008, PMID 18657511). Ligate zinc finger array fragments with BbsI-digested pBR-UV5-GP-FD2 vector backbone to create plasmids that express the zinc finger array as a FLAG-tagged Gal11P fusion in the B2H system. The lacUV5 promoter which drives expression of the Gal11P fusion protein contains a lac operator and therefore can be repressed by lac repressor. This plasmid is a low copy number plasmid and therefore we recommend that minipreps be performed from a 4 to 10 ml culture. Annotations for pMLM36: 12-17: lacUV5 promoter -35 box / 36-41: lacUV5 promoter -10 box / 48: lacUV5 promoter transcription start point / 86-88: Start codon for Gal11P protein fragment / 89-358: Coding sequence for Gal11P a.a. 263-352 (with additional translationally silent mutations) / 407-412: BbsI site #1 / 433-438: BbsI site #2 / 568-1024: f1 phage origin of replication / 1156-2013: beta-lactamase gene cassette (confers resistance to ampicillin and carbenicillin) / 2016-2956: ColE1 origin of replication (plasmid origin) / 3203-3390: rop gene (associated with regulation of copy number)

Proper citation: RRID:Addgene_21871 Copy   

•   Source: Addgene

http://www.addgene.org/21873

Vector Backbone Description: Backbone Size:5725; Vector Backbone:pMLM292; Vector Types:Mammalian Expression, zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20010934
Comments: Zinc fingers are cloned in between the unique XbaI and BamHI sites. This results in an expression vector which encodes a ZFN with the OPEN zinc finger array fused to the mutant FokI nuclease domain. pMLM292 is identical to pST1374 except that it harbors two mutations in the FokI nuclease domain (Q486E, I499L; aka the “-“ mutation see Miller et al., Nat. Biotech 2007, PMID 17603475) which confers heterodimeric behavior on these domains 235- 822: CMV promoter / 771-775: CAAT box / 804-808: TATA box / 819: 3' end of hCMV / 904-906: ZFN start codon / 910-930: SV40 nuclease localization signal (NLS) / 940- 963: FLAG tag / 964- 969: XbaI site / 980- 985: BamHI site / 986-1573: FokI nuclease domain / 1292&1294: Q486E heterodimer FokI mutation / 1331: I499L heterodimer FokI mutation / 1574-1576: ZFN stop codon / 1686-1910: BGH polyadenylation sequence / 1956-2384: f1 origin / 2411-2720: SV40 early promoter and origin / 2775-2841: EM-7 Promoter / 2842-3240: Blasticidin resistance gene / 3398-3528: SV40 late polyA signal / 3955-4574: pUC origin / 4729-5589: ampicillin (bla) resistance gene (complementary strand) / 5590-5688: bla promoter (complementary strand)

Proper citation: RRID:Addgene_21873 Copy   

•   Source: Addgene

http://www.addgene.org/21761

Genetic Insert: ECFP -EYFP linked by flexible linker containing two SGGSGG repeats
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5200; Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17073440

Proper citation: RRID:Addgene_21761 Copy   

•   Source: Addgene

http://www.addgene.org/21867

Species: Mesoplasma florum
Genetic Insert: Lon
Vector Backbone Description: Backbone Marker:Beckwith Lab; Backbone Size:5352; Vector Backbone:pBAD33; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:18852454
Comments: A detailed protocol for purification of mf-lon can be found in the associated paper.

Proper citation: RRID:Addgene_21867 Copy   

•   Source: Addgene

http://www.addgene.org/21967

Genetic Insert: CMV d2eGFP CXCR4 control sponge
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17694064
Comments: From Supplementary Table 1: "CXCR4 bulged Renilla luciferase reporter, 7 sites or 1 site; CMV sponge, 7 sites; U6 spong, 4 sites: AAGUUUUCAGAAAGCUAACA"

Proper citation: RRID:Addgene_21967 Copy   

•   Source: Addgene

http://www.addgene.org/21964

Species: Homo sapiens
Genetic Insert: si NEDD9
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17676035

Proper citation: RRID:Addgene_21964 Copy   

•   Source: Addgene

http://www.addgene.org/22019

Species: Aequorea Victoria
Genetic Insert: VN173
Vector Backbone Description: Backbone Marker:Fire lab 1995 kit; Backbone Size:3993; Vector Backbone:pPD4983; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18388940
Comments: Hiatt, S.M., Shyu, Y., Duren, H.M, and Hu, C.D. Bimolecular fluorescence complementation (BiFC) analysis of protein interactions in living C. elegans. Methods, 45:185-191 (2008) Multicloning sites betwee Myc and VN173 are avaialble

Proper citation: RRID:Addgene_22019 Copy   

•   Source: Addgene

http://www.addgene.org/21961

Genetic Insert: Ires GFP
Vector Backbone Description: Backbone Size:11476; Vector Backbone:LZRS-pBMN-Z-delta; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16814714

Proper citation: RRID:Addgene_21961 Copy   

•   Source: Addgene

http://www.addgene.org/21894

Genetic Insert: EF1 alpha -miR26a GFP p(A)
Vector Backbone Description: Backbone Size:3952; Vector Backbone:pEMBL; Vector Types:Mammalian Expression, AAV, sc; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19524505
Comments: miR-26a sequence is 5'-TTCAAGTAATCCAGGATAGGC Addgene sequencing results confirm the presence of both FseI sites flanking miR-26a.

Proper citation: RRID:Addgene_21894 Copy   

•   Source: Addgene

http://www.addgene.org/21914

Species: Mus musculus
Genetic Insert: CHOP
Vector Backbone Description: Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8650547
Comments: Addgene sequencing results show 6bp insertion in the sequencing adding 2 Gly residues immediately after the Myc tag. Mammalian expression plasmid encoding wildtype mouse CHOP fused to DNA-binding domain of yeast Gal4.

Proper citation: RRID:Addgene_21914 Copy   

•   Source: Addgene

http://www.addgene.org/21926

Species: Homo sapiens
Genetic Insert: hnRNPF
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4700; Vector Backbone:p3xFLAG-CMV-7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18573884

Proper citation: RRID:Addgene_21926 Copy   

•   Source: Addgene

http://www.addgene.org/21906

Species: Mus musculus
Genetic Insert: Oct4i
Vector Backbone Description: Backbone Size:7558; Vector Backbone:pSicoR; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19587682
Comments: Oct4 RNAi sequence 5'-GAACCTGGCTAAGCTTCCA

Proper citation: RRID:Addgene_21906 Copy   

•   Source: Addgene