Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pGal4BD-CRY2PHR Resource Report Resource Website 1+ mentions |
RRID:Addgene_28244 | cry2 | Arabidopsis thaliana | Kanamycin | PMID:21037589 | Backbone Size:7480; Vector Backbone:na; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:11 | 1 | ||
|
pEMS1113 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29042 | Ple51 | Homo sapiens | Ampicillin | PMID:20807748 | Backbone Size:17451; Vector Backbone:pEMS1302; Vector Types:Pleiades Promoter Project [sic, Pleaides Plieades]; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:12 | 1 | ||
|
MyD116.delC.pBABEpu Resource Report Resource Website 1+ mentions |
RRID:Addgene_21835 | GADD34 | Mus musculus | Ampicillin | PMID:11381086 | The construct was created by recovering the Sma1 fragment of mMyD116 and ligating it into the unique SnB1 site of pBABEpu. The stop codo is deep in the downstream SV40 promoter sequence andowing the encoded poly-peptide with a tail of nonesense sequence, but it does serve as an expressed negative control for the effects of GADD34. | Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:06 | 1 | |
|
pXDC61-FabI Resource Report Resource Website 1+ mentions |
RRID:Addgene_21842 | fabI | L. pneumophila | Chloramphenicol | PMID:19578436 | Backbone Size:9869; Vector Backbone:pXDC61; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:12:06 | 1 | ||
|
haA1.pBABEpu Resource Report Resource Website 1+ mentions |
RRID:Addgene_21813 | GADD34 C-term | Cricetulus longicaudatus (long-tailed hamster) | Ampicillin | PMID:11381086 | Hamster GADD34 C-term was isolated in a somatic cell genetic screen as a high dose supressor of the intergated stess response. The insert from the retrovirus isolated in that screen was recloned into unique BamH1 and Sal1 sites of pBABEpu and confirmed to suppress the ISR when introduced back into cells. | Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:05 | 2 | |
|
pQE-nTR Resource Report Resource Website 1+ mentions |
RRID:Addgene_21812 | pQE-nTR | Homo sapiens | Ampicillin | PMID:15226295 | Backbone Marker:Qiagen; Backbone Size:4700; Vector Backbone:pQE-80L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | His tag and aa95-113 were removed from pQE-hTR | 2026-08-15 01:12:05 | 2 | |
|
PERK 4: PERKKD-pGEX4T-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21817 | PERK (537-1114) | Mus musculus | Ampicillin | PMID:9930704 | Mouse PERK (537-1114), wild-type, 9E10-tagged at C-terminus, fused to GST, bacterial expression vector, pGEX4T-1 Sequencing found a S1109T mutation. There is no evidence that the mutation affects activity. | Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | PERK Kinase Domain. Amino acids 537-1114. | 2026-08-15 01:12:06 | 3 |
|
SV40 1: pBSSVD2005 Resource Report Resource Website 10+ mentions |
RRID:Addgene_21826 | SV40 Large T | simian virus | Ampicillin | SV40 large T antigen for immortalizing cells. See Author's Map for more information. Please note that this plasmid likely expreses a truncated SV40 large T antigen protein starting with the methionine at amino acid 109, when compared to GenBank reference sequence YP_003708382.1 (see NC_001669.1 for the corresponding nucleotide sequence). The plasmid functions as described to immortalize MEFs. | Backbone Size:3200; Vector Backbone:Bluescribe; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | likely expresses aa109-708 of the large T antigen | 2026-08-15 01:12:05 | 42 | |
|
pMLM36 (aka pBR-UV5-GP-FD2) Resource Report Resource Website 1+ mentions |
RRID:Addgene_21871 | Ampicillin | PMID:19798082 | Combinatorial libraries of zinc finger arrays made by OPEN are cloned into this plasmid (see Maeder et al., Mol Cel 2008, PMID 18657511). Ligate zinc finger array fragments with BbsI-digested pBR-UV5-GP-FD2 vector backbone to create plasmids that express the zinc finger array as a FLAG-tagged Gal11P fusion in the B2H system. The lacUV5 promoter which drives expression of the Gal11P fusion protein contains a lac operator and therefore can be repressed by lac repressor. This plasmid is a low copy number plasmid and therefore we recommend that minipreps be performed from a 4 to 10 ml culture. Annotations for pMLM36: 12-17: lacUV5 promoter -35 box / 36-41: lacUV5 promoter -10 box / 48: lacUV5 promoter transcription start point / 86-88: Start codon for Gal11P protein fragment / 89-358: Coding sequence for Gal11P a.a. 263-352 (with additional translationally silent mutations) / 407-412: BbsI site #1 / 433-438: BbsI site #2 / 568-1024: f1 phage origin of replication / 1156-2013: beta-lactamase gene cassette (confers resistance to ampicillin and carbenicillin) / 2016-2956: ColE1 origin of replication (plasmid origin) / 3203-3390: rop gene (associated with regulation of copy number) | Backbone Size:3508; Vector Backbone:pMLM36; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:06 | 1 | |||
|
pMLM292 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21873 | Ampicillin | PMID:20010934 | Zinc fingers are cloned in between the unique XbaI and BamHI sites. This results in an expression vector which encodes a ZFN with the OPEN zinc finger array fused to the mutant FokI nuclease domain. pMLM292 is identical to pST1374 except that it harbors two mutations in the FokI nuclease domain (Q486E, I499L; aka the “-“ mutation see Miller et al., Nat. Biotech 2007, PMID 17603475) which confers heterodimeric behavior on these domains 235- 822: CMV promoter / 771-775: CAAT box / 804-808: TATA box / 819: 3' end of hCMV / 904-906: ZFN start codon / 910-930: SV40 nuclease localization signal (NLS) / 940- 963: FLAG tag / 964- 969: XbaI site / 980- 985: BamHI site / 986-1573: FokI nuclease domain / 1292&1294: Q486E heterodimer FokI mutation / 1331: I499L heterodimer FokI mutation / 1574-1576: ZFN stop codon / 1686-1910: BGH polyadenylation sequence / 1956-2384: f1 origin / 2411-2720: SV40 early promoter and origin / 2775-2841: EM-7 Promoter / 2842-3240: Blasticidin resistance gene / 3398-3528: SV40 late polyA signal / 3955-4574: pUC origin / 4729-5589: ampicillin (bla) resistance gene (complementary strand) / 5590-5688: bla promoter (complementary strand) | Backbone Size:5725; Vector Backbone:pMLM292; Vector Types:Mammalian Expression, zebrafish expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:06 | 6 | |||
|
pET28CLY2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21761 | ECFP -EYFP linked by flexible linker containing two SGGSGG repeats | Kanamycin | PMID:17073440 | Backbone Marker:Novagen; Backbone Size:5200; Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:05 | 1 | |||
|
pBAD33-mf-lon Resource Report Resource Website 1+ mentions |
RRID:Addgene_21867 | Lon | Mesoplasma florum | Chloramphenicol | PMID:18852454 | A detailed protocol for purification of mf-lon can be found in the associated paper. | Backbone Marker:Beckwith Lab; Backbone Size:5352; Vector Backbone:pBAD33; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | all TGA codons changed to TGG codons | 2026-08-15 01:12:06 | 2 |
|
CMV-d2eGFP-cxcr4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21967 | CMV d2eGFP CXCR4 control sponge | Ampicillin | PMID:17694064 | From Supplementary Table 1: "CXCR4 bulged Renilla luciferase reporter, 7 sites or 1 site; CMV sponge, 7 sites; U6 spong, 4 sites: AAGUUUUCAGAAAGCUAACA" | Backbone Size:5000; Vector Backbone:pcDNA5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:07 | 3 | ||
|
pLKO-shD Resource Report Resource Website 1+ mentions |
RRID:Addgene_21964 | si NEDD9 | Homo sapiens | Ampicillin | PMID:17676035 | Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:07 | 2 | ||
|
pCE-BiFC-VN173 Resource Report Resource Website 1+ mentions |
RRID:Addgene_22019 | VN173 | Aequorea Victoria | Ampicillin | PMID:18388940 | Hiatt, S.M., Shyu, Y., Duren, H.M, and Hu, C.D. Bimolecular fluorescence complementation (BiFC) analysis of protein interactions in living C. elegans. Methods, 45:185-191 (2008) Multicloning sites betwee Myc and VN173 are avaialble | Backbone Marker:Fire lab 1995 kit; Backbone Size:3993; Vector Backbone:pPD4983; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:12:07 | 3 |
|
LZRS-IresGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_21961 | Ires GFP | Ampicillin | PMID:16814714 | Backbone Size:11476; Vector Backbone:LZRS-pBMN-Z-delta; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | GACAGATGACTATGCAGAGAT | 2026-08-15 01:12:07 | 5 | ||
|
sc AAV miR26a eGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_21894 | EF1 alpha -miR26a GFP p(A) | Ampicillin | PMID:19524505 | miR-26a sequence is 5'-TTCAAGTAATCCAGGATAGGC Addgene sequencing results confirm the presence of both FseI sites flanking miR-26a. | Backbone Size:3952; Vector Backbone:pEMBL; Vector Types:Mammalian Expression, AAV, sc; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:12:06 | 3 | |
|
9E10.ChWT.Gal4.pCDNA1/AMP Resource Report Resource Website 1+ mentions |
RRID:Addgene_21914 | CHOP | Mus musculus | Ampicillin | PMID:8650547 | Addgene sequencing results show 6bp insertion in the sequencing adding 2 Gly residues immediately after the Myc tag. Mammalian expression plasmid encoding wildtype mouse CHOP fused to DNA-binding domain of yeast Gal4. | Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:06 | 1 | |
|
p3x-FLAG-hnRNPF Resource Report Resource Website 1+ mentions |
RRID:Addgene_21926 | hnRNPF | Homo sapiens | Ampicillin | PMID:18573884 | Backbone Marker:Invitrogen; Backbone Size:4700; Vector Backbone:p3xFLAG-CMV-7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:07 | 1 | ||
|
pSicoR-mCh-Oct4i Resource Report Resource Website 1+ mentions |
RRID:Addgene_21906 | Oct4i | Mus musculus | Ampicillin | PMID:19587682 | Oct4 RNAi sequence 5'-GAACCTGGCTAAGCTTCCA | Backbone Size:7558; Vector Backbone:pSicoR; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:06 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
