Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: ARID4B
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Cloning source: K562
Proper citation: RRID:Addgene_132481 Copy
Species: Homo sapiens
Genetic Insert: Repressor Activator Protein 1 delta Br delta M
Vector Backbone Description: Backbone Size:5700; Vector Backbone:pLPC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14565979
Proper citation: RRID:Addgene_13256 Copy
Species: Homo sapiens
Genetic Insert: Repressor Activator Protein 1 delta Myb
Vector Backbone Description: Backbone Size:5700; Vector Backbone:pLPC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14565979
Proper citation: RRID:Addgene_13253 Copy
Species: Homo sapiens
Genetic Insert: Repressor Activator Protein 1 delta CT
Vector Backbone Description: Backbone Size:5700; Vector Backbone:pLPC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14565979
Proper citation: RRID:Addgene_13252 Copy
Species: Homo sapiens
Genetic Insert: FOXP3
Vector Backbone Description: Backbone Size:0; Vector Backbone:pRV.GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16873067
Comments: pRV GFP has IRES, EGFP, MMLV LTR.
Proper citation: RRID:Addgene_13250 Copy
Species: Homo sapiens
Genetic Insert: ZNF624
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Cloning source: K562
Proper citation: RRID:Addgene_132511 Copy
Species: Homo sapiens
Genetic Insert: NEFL
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4001; Vector Backbone:pEGFP-C1 with EGFP sequence removed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31574566
Proper citation: RRID:Addgene_132593 Copy
Species: Homo sapiens
Genetic Insert: NEFL
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4001; Vector Backbone:pEGFP-C1 with EGFP sequence removed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31574566
Proper citation: RRID:Addgene_132591 Copy
Species: Homo sapiens
Genetic Insert: LRP6 (20–1244)
Vector Backbone Description: Vector Backbone:pAcGP67A; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21984209
Proper citation: RRID:Addgene_132629 Copy
Species: Homo sapiens
Genetic Insert: LRP6 (630–1244)
Vector Backbone Description: Vector Backbone:pAcGP67A; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21984209
Proper citation: RRID:Addgene_132628 Copy
Species: Homo sapiens
Genetic Insert: LRP6 (20–629)
Vector Backbone Description: Vector Backbone:pAcGP67A; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21984209
Proper citation: RRID:Addgene_132627 Copy
Species: Homo sapiens
Genetic Insert: MBP-Norrin ( 31–133)
Vector Backbone Description: Vector Backbone:pAcGP67B; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26227961
Proper citation: RRID:Addgene_132625 Copy
Species: Homo sapiens
Genetic Insert: NEFL
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4001; Vector Backbone:pEGFP-C1 with EGFP sequence removed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31574566
Proper citation: RRID:Addgene_132589 Copy
Species: Homo sapiens
Genetic Insert: Fzd4 CRD (38–160)
Vector Backbone Description: Vector Backbone:pAcGP67B; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26227961
Proper citation: RRID:Addgene_132621 Copy
Species: Homo sapiens
Genetic Insert: TSC1 (939-992)
Vector Backbone Description: Vector Backbone:pCool; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26893383
Proper citation: RRID:Addgene_132618 Copy
Species: Homo sapiens
Genetic Insert: TBC1D7 (19-293)
Vector Backbone Description: Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26893383
Proper citation: RRID:Addgene_132617 Copy
Species: Homo sapiens
Genetic Insert: RNF146
Vector Backbone Description: Vector Backbone:pGEX-6P2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25327252
Proper citation: RRID:Addgene_132610 Copy
Species: Homo sapiens
Genetic Insert: gRNAs targeting 388 human Solute Carrier genes
Vector Backbone Description: Backbone Marker:Feng Zhang lab (Addgene plasmid #61427); Vector Backbone:lenti sgRNA(MS2)_zeo backbone; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36114003
Proper citation: RRID:Addgene_132561 Copy
Species: Homo sapiens
Genetic Insert: human miR-302 cluster: MIR302B, MIR302C, MIR302A, MIR302D, MIR367
Vector Backbone Description: Backbone Marker:Broad Insitute; Backbone Size:8405; Vector Backbone:pCW57-GFP-2A-MCS; Vector Types:Mammalian Expression, Lentiviral, Doxycycline inducible, microRNA expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31673026
Comments: MIR302 cluster was PCR-amplified from genomic DNA using the following primers: Fwd - ACACCGGTGAAGTTGTATGTTGGGTGGGCT; Rev - CGTGTACACGTTATTTAACAATCCATCACCATTGCTAAAGT and cloned into pJET. pJET was digested using AgeI/BsrGI and inserted into AgeI/BsrGI digested pCW57-GFP-MCS vector (Addgene #71783).
Proper citation: RRID:Addgene_132549 Copy
Species: Homo sapiens
Genetic Insert: DYNLRB1
Vector Backbone Description: Backbone Marker:Geneva Biotech; Backbone Size:2922; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:31451806
Comments: Cloned by Ruta Zalyte in Andrew Carter's lab. For cloning strategy, please refer to the Methods section of Toropova et al 2019.
Proper citation: RRID:Addgene_132533 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
