Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Ruminoccocus flavefaciens XPD3002
Genetic Insert: dRanCas13b
Vector Backbone Description: Vector Backbone:pHAGE-EF1a-IRES-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31757757
Comments: Plasmid is prone to recombination. Test multiple colonies to ensure the full plasmid is isolated.
Proper citation: RRID:Addgene_132409 Copy
Species: Prevotella sp. P5-125
Genetic Insert: dPspCas13b
Vector Backbone Description: Vector Backbone:pHAGE-EF1a-IRES-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31757757
Comments: Plasmid is prone to recombination. Test multiple colonies to ensure the full plasmid is isolated.
Proper citation: RRID:Addgene_132404 Copy
Species: Prevotella sp. P5-125
Genetic Insert: dPspCas13b
Vector Backbone Description: Vector Backbone:pHAGE-EF1a-IRES-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31757757
Comments: Plasmid is prone to recombination. Test multiple colonies to ensure the full plasmid is isolated.
Proper citation: RRID:Addgene_132403 Copy
Species: Prevotella sp. P5-125
Genetic Insert: dPspCas13b
Vector Backbone Description: Vector Backbone:pHAGE-EF1a-IRES-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31757757
Comments: Plasmid is prone to recombination. Test multiple colonies to ensure the full plasmid is isolated.
Proper citation: RRID:Addgene_132402 Copy
Species: Homo sapiens
Genetic Insert: Repressor Activator Protein 1 delta CT
Vector Backbone Description: Backbone Size:5700; Vector Backbone:pLPC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14565979
Proper citation: RRID:Addgene_13252 Copy
Species: Homo sapiens
Genetic Insert: FOXP3
Vector Backbone Description: Backbone Size:0; Vector Backbone:pRV.GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16873067
Comments: pRV GFP has IRES, EGFP, MMLV LTR.
Proper citation: RRID:Addgene_13250 Copy
Species: Homo sapiens
Genetic Insert: NEFL
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4001; Vector Backbone:pEGFP-C1 with EGFP sequence removed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31574566
Proper citation: RRID:Addgene_132589 Copy
Species: Homo sapiens
Genetic Insert: RNF146
Vector Backbone Description: Vector Backbone:pGEX-6P2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25327252
Proper citation: RRID:Addgene_132610 Copy
Species: Arabidopsis thaliana
Genetic Insert: egg cell promoter, Cas9-mApple, pds3 sgRNA
Vector Backbone Description: Backbone Marker:https://gateway.psb.ugent.be; Backbone Size:8820; Vector Backbone:pH2GW7; Vector Types:Plant Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32096870
Comments: Egg cell promoters amplified directly from A. thaliana leaf tissue based on the promoters in Addgene plasmid #71288, described in doi: 10.1186/s13059-015-0715-0 Please visit https://www.biorxiv.org/content/10.1101/852020v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_132568 Copy
Species: Homo sapiens
Genetic Insert: human miR-302 cluster: MIR302B, MIR302C, MIR302A, MIR302D, MIR367
Vector Backbone Description: Backbone Marker:Broad Insitute; Backbone Size:8405; Vector Backbone:pCW57-GFP-2A-MCS; Vector Types:Mammalian Expression, Lentiviral, Doxycycline inducible, microRNA expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31673026
Comments: MIR302 cluster was PCR-amplified from genomic DNA using the following primers: Fwd - ACACCGGTGAAGTTGTATGTTGGGTGGGCT; Rev - CGTGTACACGTTATTTAACAATCCATCACCATTGCTAAAGT and cloned into pJET. pJET was digested using AgeI/BsrGI and inserted into AgeI/BsrGI digested pCW57-GFP-MCS vector (Addgene #71783).
Proper citation: RRID:Addgene_132549 Copy
Species: Caenorhabditis elegans
Genetic Insert: mNG-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:3881; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26044593
Proper citation: RRID:Addgene_132523 Copy
Species: Homo sapiens
Genetic Insert: L1CAM
Vector Backbone Description: Backbone Size:5450; Vector Backbone:pcDNA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15647482
Proper citation: RRID:Addgene_13269 Copy
Species: Synthetic
Genetic Insert: sybody_MBP#1
Vector Backbone Description: Backbone Size:3978; Vector Backbone:pSB_init; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:32269381
Proper citation: RRID:Addgene_132699 Copy
Species: Mus musculus
Genetic Insert: Carnosine dipeptidase 2
Vector Backbone Description: Backbone Marker:Penn Vector Core; Backbone Size:5700; Vector Backbone:pENN.AAV.CB7.CI.insert.WPRE.rBG; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31587987
Proper citation: RRID:Addgene_132685 Copy
Species: Mus musculus
Genetic Insert: Peptidase M20 domain containing 2
Vector Backbone Description: Backbone Marker:Penn Vector Core; Backbone Size:5700; Vector Backbone:pENN.AAV.CB7.CI.insert.WPRE.rBG; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31587987
Proper citation: RRID:Addgene_132684 Copy
Species: Mus musculus
Genetic Insert: Peptidase M20 domain containing 1
Vector Backbone Description: Backbone Marker:Penn Vector Core; Backbone Size:5700; Vector Backbone:pENN.AAV.CB7.CI.insert.WPRE.rBG; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31587987
Proper citation: RRID:Addgene_132682 Copy
Species: RSF1010 plasmid
Genetic Insert: MobA
Vector Backbone Description: Backbone Marker:-; Backbone Size:17500; Vector Backbone:pRL623; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31585408
Comments: Please note that Addgene found mutations Q291P, P416T, P595S, H623D in mobA during our quality control process. The depositing lab confirmed these mutations do not affect plasmid function, and the plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_132664 Copy
Species: Other
Genetic Insert: aadA
Vector Backbone Description: Backbone Marker:-; Backbone Size:6300; Vector Backbone:pAM5404; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:31585408
Proper citation: RRID:Addgene_132662 Copy
Species: Rattus norvegicus
Genetic Insert: 14-3-3 gamma
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_13274 Copy
Species: Homo sapiens
Genetic Insert: 14-3-3 beta
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_13270 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
