Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8524249
Proper citation: RRID:Addgene_22227 Copy
Species: H. sodomense
Genetic Insert: Arch
Vector Backbone Description: Backbone Marker:Scott Sternson; Backbone Size:5000; Vector Backbone:AAV-FLEX; Vector Types:Mammalian Expression, AAV, Cre/Lox, adeno-associated virus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20054397
Comments: PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.
In the map below, the Selected Features list should be labeled as follows (instead of the 3 loxP sites listed from 3629-3692 and 5299-5403):
lox2272: 3629-3596 , loxp: 3725-3692
lox2272: 5266-5399 , loxp: 5370-5403
Proper citation: RRID:Addgene_22222 Copy
Species: Homo sapiens
Genetic Insert: Oculocerebrorenal syndrome of Lowe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Bacterial Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17765681
Proper citation: RRID:Addgene_22207 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RAD5
Vector Backbone Description: Backbone Size:6112; Vector Backbone:YCplac111; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18757916
Comments: Mutation abolishes the ubiquitin ligase function
Proper citation: RRID:Addgene_22288 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RAD5
Vector Backbone Description: Backbone Size:6112; Vector Backbone:YCplac111; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18757916
Proper citation: RRID:Addgene_22289 Copy
Species: Homo sapiens
Genetic Insert: SA-OCT-GFP-2APuro-PA
Vector Backbone Description: Backbone Size:5468; Vector Backbone:N/A; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19680244
Proper citation: RRID:Addgene_22211 Copy
Species: Homo sapiens
Genetic Insert: CAGGS-eGFP
Vector Backbone Description: Backbone Size:7357; Vector Backbone:N/A; Vector Types:ZFN donor; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19680244
Comments: This plasmid contains a ccdB gene that is non-functional.
Proper citation: RRID:Addgene_22212 Copy
Genetic Insert: Tetracycline repressor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2386; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Yeast Expression, Worm Expression, Insect Expression; Bacterial Resistance:Kanamycin
Comments: Please note that there are several sequence discrepancies between Addgene's quality control sequence and the depositor's reference sequence. These changes do not affect plasmid function.
Proper citation: RRID:Addgene_22265 Copy
Genetic Insert: Enhanced Green Fluorescent Protein
Vector Backbone Description: Backbone Marker:Eric Campeau; Backbone Size:6869; Vector Backbone:pQCXIB; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_22266 Copy
Species: Homo sapiens
Genetic Insert: cyclin-dependent kinase inhibitor 2A
Vector Backbone Description: Backbone Size:8221; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_22260 Copy
Species: Homo sapiens
Genetic Insert: HRAS G12V
Vector Backbone Description: Backbone Size:8176; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_22262 Copy
Species: Arabidopsis thaliana
Genetic Insert: IntersectinDHPH-20aaLinker-mYFP-PIF6APB
Vector Backbone Description: Backbone Size:4860; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19749742
Proper citation: RRID:Addgene_22278 Copy
Genetic Insert: shRNA Cyclin-dependent kinase inhibitor 2A (CDKN2A)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7801; Vector Backbone:pQCXIN; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
Comments: shRNA oligo sequence is 5'-GACCGTAACTATTCGGTGCGTTGGGCAGAAGCTTGTGCTCAACGCACCGAATAGTTGCGGTCTTTTT
Proper citation: RRID:Addgene_22271 Copy
Genetic Insert: SV40 small + Large T antigen
Vector Backbone Description: Backbone Size:6925; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: The small and large T antigen inactivates the TP53, RB1 and PP2A genes.
Proper citation: RRID:Addgene_22298 Copy
Genetic Insert: GFP-rad9-GFP
Vector Backbone Description: Backbone Size:4456; Vector Backbone:pRS403; Vector Types:Yeast Expression, Integrating plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19745116
Comments: GAL1 promoter, GFP silencing construct and CYC1 terminator fragment was cloned out of pYES2.1 and into pRS403.
The insert sequence can be found by clicking on the "View sequence" link. The rad9 intron loop is shown in upper case letters.
Proper citation: RRID:Addgene_22316 Copy
Species: Saccharomyces castellii
Genetic Insert: AGO1
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pRS404-PTEF; Vector Types:Yeast Expression, Integrating plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19745116
Comments: AgoI coding sequence was inserted between TEF promoter and CYC1 terminator.
Proper citation: RRID:Addgene_22313 Copy
Species: Rattus norvegicus
Genetic Insert: CREB
Vector Backbone Description: Backbone Size:3600; Vector Backbone:RSV-SG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2573431
Comments: insert can be released by digesting with HindIII/Xba1
Proper citation: RRID:Addgene_22394 Copy
Species: Rattus norvegicus
Genetic Insert: CREB
Vector Backbone Description: Backbone Size:3600; Vector Backbone:RSV-SG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2573431
Proper citation: RRID:Addgene_22395 Copy
Species: Rattus norvegicus
Genetic Insert: microtubule-associated protein 1 light chain 3 beta
Vector Backbone Description: Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18094039
Comments: LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. Kabeya Y et al. (EMBO J. 2000 Nov 1. 19(21):5720-8.
Proper citation: RRID:Addgene_22405 Copy
Species: Homo sapiens
Genetic Insert: codon optimised wild type Calcineurin A
Vector Backbone Description: Backbone Size:7678; Vector Backbone:SFG; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19770360
Proper citation: RRID:Addgene_22489 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
