Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pHAGE-IRES-puro-NLS-dRanCas13b-EGFP-NLS-3xFlag Resource Report Resource Website 1+ mentions |
RRID:Addgene_132409 | dRanCas13b | Ruminoccocus flavefaciens XPD3002 | Ampicillin | PMID:31757757 | Plasmid is prone to recombination. Test multiple colonies to ensure the full plasmid is isolated. | Vector Backbone:pHAGE-EF1a-IRES-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | H147A; H1044A | 2026-08-15 01:05:28 | 1 |
|
pHAGE-IRES-puro-NLS-NLS-dPspCas13b-3xsfGFP-NLS Resource Report Resource Website 1+ mentions |
RRID:Addgene_132404 | dPspCas13b | Prevotella sp. P5-125 | Ampicillin | PMID:31757757 | Plasmid is prone to recombination. Test multiple colonies to ensure the full plasmid is isolated. | Vector Backbone:pHAGE-EF1a-IRES-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | H133A; H1059A | 2026-08-15 01:05:28 | 1 |
|
pHAGE-IRES-puro-NLS-dPspCas13b-2xmNeongreen-3xFlag Resource Report Resource Website 1+ mentions |
RRID:Addgene_132403 | dPspCas13b | Prevotella sp. P5-125 | Ampicillin | PMID:31757757 | Plasmid is prone to recombination. Test multiple colonies to ensure the full plasmid is isolated. | Vector Backbone:pHAGE-EF1a-IRES-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | H133A; H1059A | 2026-08-15 01:05:27 | 1 |
|
pHAGE-IRES-puro-NLS-dPspCas13b-2xmNeongreen-NLS-3xFlag Resource Report Resource Website 1+ mentions |
RRID:Addgene_132402 | dPspCas13b | Prevotella sp. P5-125 | Ampicillin | PMID:31757757 | Plasmid is prone to recombination. Test multiple colonies to ensure the full plasmid is isolated. | Vector Backbone:pHAGE-EF1a-IRES-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | H133A; H1059A | 2026-08-15 01:05:27 | 1 |
|
pLPC FLAG hRap1 delta CT Resource Report Resource Website 1+ mentions |
RRID:Addgene_13252 | Repressor Activator Protein 1 delta CT | Homo sapiens | Ampicillin | PMID:14565979 | Backbone Size:5700; Vector Backbone:pLPC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | contains hRap1 aa2-270 + 331-399 and the point mutation M5L | 2026-08-15 01:05:29 | 1 | |
|
pRV.GFP FOXP3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_13250 | FOXP3 | Homo sapiens | Ampicillin | PMID:16873067 | pRV GFP has IRES, EGFP, MMLV LTR. | Backbone Size:0; Vector Backbone:pRV.GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:28 | 2 | |
|
phNFL Resource Report Resource Website 1+ mentions |
RRID:Addgene_132589 | NEFL | Homo sapiens | Kanamycin | PMID:31574566 | Backbone Marker:Clontech; Backbone Size:4001; Vector Backbone:pEGFP-C1 with EGFP sequence removed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:05:29 | 2 | ||
|
pGEX6P-2-human RNF146 full length Resource Report Resource Website 1+ mentions |
RRID:Addgene_132610 | RNF146 | Homo sapiens | Ampicillin | PMID:25327252 | Vector Backbone:pGEX-6P2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:30 | 1 | ||
|
GS2.1/EC Resource Report Resource Website 1+ mentions |
RRID:Addgene_132568 | egg cell promoter, Cas9-mApple, pds3 sgRNA | Arabidopsis thaliana | Spectinomycin | PMID:32096870 | Egg cell promoters amplified directly from A. thaliana leaf tissue based on the promoters in Addgene plasmid #71288, described in doi: 10.1186/s13059-015-0715-0 Please visit https://www.biorxiv.org/content/10.1101/852020v1 for bioRxiv preprint. | Backbone Marker:https://gateway.psb.ugent.be; Backbone Size:8820; Vector Backbone:pH2GW7; Vector Types:Plant Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Spectinomycin | 2026-08-15 01:05:29 | 1 | |
|
pCW57-GFP-miR-302cluster Resource Report Resource Website 1+ mentions |
RRID:Addgene_132549 | human miR-302 cluster: MIR302B, MIR302C, MIR302A, MIR302D, MIR367 | Homo sapiens | Ampicillin | PMID:31673026 | MIR302 cluster was PCR-amplified from genomic DNA using the following primers: Fwd - ACACCGGTGAAGTTGTATGTTGGGTGGGCT; Rev - CGTGTACACGTTATTTAACAATCCATCACCATTGCTAAAGT and cloned into pJET. pJET was digested using AgeI/BsrGI and inserted into AgeI/BsrGI digested pCW57-GFP-MCS vector (Addgene #71783). | Backbone Marker:Broad Insitute; Backbone Size:8405; Vector Backbone:pCW57-GFP-2A-MCS; Vector Types:Mammalian Expression, Lentiviral, Doxycycline inducible, microRNA expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:29 | 1 | |
|
pDD268 Resource Report Resource Website 1+ mentions |
RRID:Addgene_132523 | mNG-C1^SEC^3xFlag | Caenorhabditis elegans | Ampicillin | PMID:26044593 | Backbone Size:3881; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:29 | 7 | ||
|
L1-1151Y>A Resource Report Resource Website 1+ mentions |
RRID:Addgene_13269 | L1CAM | Homo sapiens | Ampicillin | PMID:15647482 | Backbone Size:5450; Vector Backbone:pcDNA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:30 | 1 | ||
|
pSb_init containing the MBP sybody Sb_MBP#1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_132699 | sybody_MBP#1 | Synthetic | Chloramphenicol | PMID:32269381 | Backbone Size:3978; Vector Backbone:pSB_init; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:05:30 | 1 | ||
|
pENN.AAV.CB7.CI.CNDP2-flag.WPRE.rBG Resource Report Resource Website 1+ mentions |
RRID:Addgene_132685 | Carnosine dipeptidase 2 | Mus musculus | Ampicillin | PMID:31587987 | Backbone Marker:Penn Vector Core; Backbone Size:5700; Vector Backbone:pENN.AAV.CB7.CI.insert.WPRE.rBG; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:30 | 1 | ||
|
pENN.AAV.CB7.CI.PM20D2-flag.WPRE.rBG Resource Report Resource Website 1+ mentions |
RRID:Addgene_132684 | Peptidase M20 domain containing 2 | Mus musculus | Ampicillin | PMID:31587987 | Backbone Marker:Penn Vector Core; Backbone Size:5700; Vector Backbone:pENN.AAV.CB7.CI.insert.WPRE.rBG; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:30 | 1 | ||
|
pENN.AAV.CB7.CI.PM20D1-flag.WPRE.rBG Resource Report Resource Website 1+ mentions |
RRID:Addgene_132682 | Peptidase M20 domain containing 1 | Mus musculus | Ampicillin | PMID:31587987 | Backbone Marker:Penn Vector Core; Backbone Size:5700; Vector Backbone:pENN.AAV.CB7.CI.insert.WPRE.rBG; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:30 | 7 | ||
|
pAM5505 Resource Report Resource Website 1+ mentions |
RRID:Addgene_132664 | MobA | RSF1010 plasmid | Chloramphenicol | PMID:31585408 | Please note that Addgene found mutations Q291P, P416T, P595S, H623D in mobA during our quality control process. The depositing lab confirmed these mutations do not affect plasmid function, and the plasmid functions as described in the associated publication. | Backbone Marker:-; Backbone Size:17500; Vector Backbone:pRL623; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | please see depositor comments below | 2026-08-15 01:05:30 | 1 |
|
pAM5409 Resource Report Resource Website 1+ mentions |
RRID:Addgene_132662 | aadA | Other | Spectinomycin and Streptomycin | PMID:31585408 | Backbone Marker:-; Backbone Size:6300; Vector Backbone:pAM5404; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-08-15 01:05:30 | 1 | ||
|
pcDNA3-HA-14-3-3 gamma Resource Report Resource Website 1+ mentions |
RRID:Addgene_13274 | 14-3-3 gamma | Rattus norvegicus | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:31 | 3 | |||
|
pcDNA3-HA-14-3-3 beta Resource Report Resource Website 1+ mentions |
RRID:Addgene_13270 | 14-3-3 beta | Homo sapiens | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:30 | 8 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
