Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: φC31(PhiC31)
Vector Backbone Description: Backbone Marker:NA; Backbone Size:5218; Vector Backbone:pET28a(+)v2; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: We use a tag-free SUMO protease (ulp1) for cleaving the TwinStrep tag from the final product. Tag-free ulp1 can be synthesized using Addgene Plasmid #190063 and a His-tagged TEV protease or HRV-3C protease (PreScission protease).
The total insert size displayed on this page (2403bp) includes all tags and linkers.
Proper citation: RRID:Addgene_246982 Copy
Species: Other
Genetic Insert: CaMV 35S::dCas9
Vector Backbone Description: Vector Backbone:Binary; Vector Types:Plant Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38769424
Proper citation: RRID:Addgene_239940 Copy
Species: Other
Genetic Insert: CaMV 35S-SynPro-01::Rluc
Vector Backbone Description: Vector Backbone:pBluescript SK(+); Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38769424
Proper citation: RRID:Addgene_239946 Copy
Species: Other
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:42199375
Comments: Genotype: E. coli B F- ompT gal dcm lon hsdSB(rB–mB–) λ(DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB+]K-12(λS) ΔendA ΔrecA glvC ::[ phlFAM, cymRAM, luxR, vanRAM, lacIAM, tetR ]
Fast growth at 37C in LB (doubling time ~ 20-25 minutes) and improved DNA (endA, recA) and protein stability (lon, ompT).
Strain validation:
- PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 5 518 bp.
- PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1160(GCTTGTCGACGACGGC) generates a product of 140 bp.
- PCR using OR1157 (TACCCCAGTTGGGGCAC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 110 bp. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint.
Proper citation: RRID:Addgene_235121 Copy
Species: Other
Genetic Insert: CaMV 35S::dCas9
Vector Backbone Description: Vector Backbone:pBluescript SK(+); Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38769424
Proper citation: RRID:Addgene_239937 Copy
Species: Other
Genetic Insert: CaMV 35S::Rluc
Vector Backbone Description: Vector Backbone:pBluescript SK(+); Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38769424
Proper citation: RRID:Addgene_239887 Copy
Species: Other
Genetic Insert: KI gRNA for Nlgn2
Vector Backbone Description: Vector Backbone:pHnS; Vector Types:AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_240303 Copy
Species: Other
Genetic Insert: Rluc
Vector Backbone Description: Vector Backbone:pAGM9121; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38769424
Proper citation: RRID:Addgene_239943 Copy
Species: Other
Genetic Insert: Csy4 recognition sequence
Vector Backbone Description: Vector Backbone:pAGM9121; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38769424
Proper citation: RRID:Addgene_239935 Copy
Species: Other
Genetic Insert: Csy4
Vector Backbone Description: Vector Backbone:pAGM9121; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38769424
Proper citation: RRID:Addgene_239934 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pAGM9121; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38769424
Proper citation: RRID:Addgene_239933 Copy
Species: Other
Genetic Insert: Chikungunya virus 181/25 strain structural proteins
Vector Backbone Description: Vector Backbone:pSIN; Vector Types:Sindbis virus helper construct; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2025.06.25.661405 for bioRxiv preprint.
Proper citation: RRID:Addgene_242479 Copy
Species: Other
Genetic Insert: ECS-dSC
Vector Backbone Description: Vector Backbone:pAAV-mGFAP(ABC1D)-*-WPRE-HBGpA; Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2025.03.18.643859 for bioRxiv preprint.
Proper citation: RRID:Addgene_234546 Copy
Species: Other
Genetic Insert: IgKL-SpyCatcher003-mNeonGreen
Vector Backbone Description: Backbone Marker:VVF (p438) https://vvf.ethz.ch/ ; Vector Backbone:pAAV-P3 (Addgene plasmid #183460); Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2025.03.18.643859 for bioRxiv preprint.
Proper citation: RRID:Addgene_234543 Copy
Species: Other
Genetic Insert: dCas9-5xGCN4
Vector Backbone Description: Vector Backbone:pPB-TRE3G; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38724747
Comments: Drives DOX-inducible expression of the dCas9-5xGCN4 for epigenetic editing. This is a piggyBAC plasmid that integrates into the genome and can be selected for via Hygromycin resistance. An additional TET3G insert enables the doxycyline-indicuible system to operate.
Proper citation: RRID:Addgene_235572 Copy
Species: Other
Genetic Insert: translational release factor 2
Vector Backbone Description: Vector Backbone:pSC101; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29131146
Comments: Gene comes from E.coli.
Proper citation: RRID:Addgene_111474 Copy
Species: other
Genetic Insert: SIV Rev
Vector Backbone Description: Vector Backbone:pSIV third-generation, simian immunodeficiency based, pro-lentiviral vector; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39708809
Proper citation: RRID:Addgene_236244 Copy
Species: other
Genetic Insert: SIV Gag and Pol
Vector Backbone Description: Vector Backbone:pSIV third-generation, simian immunodeficiency based, pro-lentiviral vector; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39708809
Proper citation: RRID:Addgene_236243 Copy
Species: Other
Genetic Insert: MERS-CoV-Membrane
Vector Backbone Description: Backbone Size:2800; Vector Backbone:pENTR223.1*SfiI; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:37267226
Comments: 5'-linker: SfiI-BamHI-ATG-BamHI (GGCCGTCAaggccaggatccatgggatcc), 3'-linker: PacI-TAA-AsiSI-SfiI (cttaatTAAgacgcgatcgcggcctcatGGGCC).
Proper citation: RRID:Addgene_168832 Copy
Species: Other
Genetic Insert: CBS4-CMV1::RUBY::OCS
Vector Backbone Description: Vector Backbone:pICH47751; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39081031
Comments: Please visit https://doi.org/10.1101/2024.03.23.586378 for bioRxiv preprint.
Proper citation: RRID:Addgene_222451 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
