Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: OTUB1
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:MSCV-N-Flag-HA-IRES-PURO; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22551 Copy
Species: Homo sapiens
Genetic Insert: OTUB2
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22552 Copy
Species: Mus musculus
Genetic Insert: mSin3B
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5565; Vector Backbone:pACT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15935060
Comments: Used to see if truncated form of mSin3b would be biologically active when binding Mouse Myt1
This short form of mSIN3B was PCR'd from the full-length clone (pcDNAAmSin3B-Flag) which was a gift of Dr. Ronald dePinho.
Proper citation: RRID:Addgene_22653 Copy
Genetic Insert: fret-STOP-fret
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11751630
Comments: Plasmid containing FRT-STOP-FRT cassette for use in expressing genes only after Flp-mediated recombination.
It's like the LSL cassette ( http://www.addgene.org/11584 but this one is a FSF cassette
Proper citation: RRID:Addgene_22774 Copy
Genetic Insert: OVA-SIY
Vector Backbone Description: Backbone Marker:Available at Addgene (#20905); Backbone Size:0; Vector Backbone:Luc.Cre (aka: UbC.Luciferase.PGK.Cre); Vector Types:Mammalian Expression, Lentiviral, Cre/Lox; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_22777 Copy
Species: Homo sapiens
Genetic Insert: Rev Erb alpha
Vector Backbone Description: Backbone Marker:Available at Addgene (#16405); Backbone Size:9000; Vector Backbone:pAdTrack-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20018698
Proper citation: RRID:Addgene_22745 Copy
Species: Mus musculus
Genetic Insert: shRev-Erbalpha
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20018698
Comments: targeting sequence: GCGCTTTGCATCGTTGTTCAA
Proper citation: RRID:Addgene_22747 Copy
Genetic Insert: microRNA 9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5699; Vector Backbone:pcDNA-6.2 GW/EmGFP miR-neg control; Vector Types:Mammalian Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:18987208
Proper citation: RRID:Addgene_22741 Copy
Genetic Insert: CXCR4 control sponge
Vector Backbone Description: Backbone Marker:Weinberg lab (Addgene#:1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19524507
Comments: Subclond from CMV-CXCR4 control sponge, as described in Ebert et al. (Nature Methods, 2007)
Sequence of sponge: AAGUUUUCAGAAAGCUAACA
Proper citation: RRID:Addgene_22744 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19668191
Comments: additional article reference: Shinmura, K. et al. Direct evidence for the role of centrosomally localized p53 in the regulation of centrosome duplication. Oncogene. 2007 May 3;26(20):2939-44. Epub 2006 Oct 30.
Proper citation: RRID:Addgene_22727 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19668191
Comments: additional article reference: Bowman, T. et al. Tissue-specific inactivation of p53 tumor suppression in the mouse. Genes Dev. 1996 Apr 1;10(7):826-35.
Proper citation: RRID:Addgene_22729 Copy
Species: mushroom
Genetic Insert: a variant of Discosoma sp. red fluorescent protein
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo; Backbone Size:4800; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19668191
Proper citation: RRID:Addgene_22724 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19668191
Proper citation: RRID:Addgene_22725 Copy
Genetic Insert: miR30
Vector Backbone Description: Backbone Size:7500; Vector Backbone:MSCV2.2 with WPRE cloned into ClaI site is the base vector; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Comments: See FLIP vector protocols (PDF from this page) for more information.
This vector contains the SwaI site for cloning multiple shRNAs into a single vector.
Proper citation: RRID:Addgene_22699 Copy
Genetic Insert: Lox66-pU(delta)TK-EM7Neo-Lox2272
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2969; Vector Backbone:pBluescript KS+; Vector Types:Cre/Lox, BAC recombineering; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21324933
Comments: Please note that the plasmid names and lox sites have been corrected since publication.
Proper citation: RRID:Addgene_22733 Copy
Species: Homo sapiens
Genetic Insert: Egg laying Nine - 2 (EglN2)
Vector Backbone Description: Backbone Size:5145; Vector Backbone:pBabe-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19878873
Proper citation: RRID:Addgene_22705 Copy
Species: Mus musculus
Genetic Insert: Myelin Transcription Factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3948; Vector Backbone:pCRII; Vector Types:cloning vector TT/AA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9373037
Comments: The murine Myt1 cDNA (6 zinc fingers) had 3 base mutations within the coding region (bp 806, 837 and 4344). These sites were corrected using Stratagene QuickChang Site-Directed mutagenesis. The Myt1 was sequenced after the mutagenesis and found to be correct. There is still one mutation in the 5' UTR at bp 529 (START codon is bp 532)
Proper citation: RRID:Addgene_22713 Copy
Genetic Insert: DTA and TK
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pKO2; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442
Proper citation: RRID:Addgene_22677 Copy
Genetic Insert: DTA
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pKO2; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442
Proper citation: RRID:Addgene_22674 Copy
Genetic Insert: Empty vector
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6861; Vector Backbone:pQCXI; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_22800 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
