Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Mentions:yes (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pLX401-INK4A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_121919 p16-INK4A Homo sapiens Ampicillin PMID:30755442 p16-INK4A was codon-optimized for synthesis as a gBlock from Integrated DNA Technologies and Gateway cloned into pLX401 (pCW57.1, Addgene #41393). Backbone Marker:David Root; Backbone Size:9354; Vector Backbone:pLX401 (pCW57.1, Addgene #41393); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:03:39 5
IL-4 promoter luciferase
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_12195 IL-4 promoter Mus musculus Ampicillin PMID:10970869 Murine IL-4 promotor from -804 to -3 relative to the transcription start site. Backbone Size:0; Vector Backbone:na; Vector Types:Bacterial Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:03:40 2
IL-2 promoter luciferase
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_12194 IL-2 promoter Mus musculus Ampicillin PMID:10970869 Murine IL-2 promotor from -585 to -34 relative to the transcription start site. Backbone Marker:ATCC; Backbone Size:0; Vector Backbone:pT81Luc; Vector Types:Bacterial Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:03:40 5
pHR-BRD4ΔN-mCherry-sspB
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_121968 BRD4 Homo sapiens Ampicillin PMID:30500535 Vector contains SspB, a bacterial protein which binds exposed SsrA tag (from iLID) at high affinity. Backbone Size:9000; Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Deleted amino acids 1-461 2026-08-15 01:03:40 1
pSEVA228-pro4IUPi
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_122018 Choline kinase Saccharomyces cerevisiae Kanamycin PMID:30584096 Backbone Marker:Silva-Rocha,R., Martinez-Garcia,E., Chavarria,M., Calles,B., Arce-Rodriguez,A., de las Heras,A., Paez-Espino,D.; Backbone Size:3465; Vector Backbone:pSEVA228; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Codon optimized for E. coli 2026-08-15 01:03:40 1
pSGAb-spe
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_122000 none Other Spectinomycin PMID:31548010 Backbone Size:6049; Vector Backbone:pUC57 and pWH1266; Vector Types:CRISPR; Bacterial Resistance:Spectinomycin 2026-08-15 01:03:40 1
pSGAb-km
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_121999 none Kanamycin PMID:31548010 Backbone Size:6073; Vector Backbone:pUC57 and pWH1266; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:03:40 3
LL - hOCT4i -1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_12198 OCT4 - RNAi Homo sapiens Ampicillin PMID:15749924 Target sequence: CATGTGTAAGCTGCGGCCCTT (NM_002701: bp 642-662) Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:03:40 1
LL - hOCT4i -2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_12197 OCT4 - RNAi Homo sapiens Ampicillin PMID:15749924 Target sequence: GGATGTGGTCCGAGTGTGGTT (NM_002701: bp 867-887) Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:03:40 1
pCMV6M-Pak1 P13A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_12207 Pak1 Homo sapiens Ampicillin PMID:8798379 Pak1 may contain a G401S mutation. Depositor states that this mutation should not affect plasmid function. Backbone Size:4900; Vector Backbone:pCMV6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin P13A: disrupts first polyproline region of Pak1 2026-08-15 01:03:41 1
pEBG-Pak1 83-149
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_12214 Pak1 Homo sapiens Ampicillin PMID:11719502 Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Dominant negative Pak1: autoinhibitory domain, aa 83-149 2026-08-15 01:03:42 3
pGEXTK-Pak1 70-117
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_12217 Pak1 Homo sapiens Ampicillin Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin PBD (p21-binding domain), aa 70-117 2026-08-15 01:03:42 24
pAAV-hsyn_NLS-His-rsCaMPARI-mRuby3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_122092 rsCaMPARI Synthetic Ampicillin PMID:32931424 Backbone Size:4270; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:03:41 1
pSEVA1213S
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_122095 I-SceI restriction endonuclease Saccharomyces cerevisiae Ampicillin PMID:30861315 Backbone Marker:de Lorenzo´s lab; Backbone Size:3224; Vector Backbone:pSEVA121; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:03:41 1
pHR-TRE3G-dCas9-10X GCN4-P2A-mCherry
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_122132 dCas9-10X GCN4-P2A-mCherry Ampicillin PMID:30318302 Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin dCas9 D10A & H840A 2026-08-15 01:03:42 1
pB-Rex
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_122134 B. subtilis Rex Gentamicin PMID:30633862 Vector Backbone:pBBR1; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:03:42 1
pROP-PP-GFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_122135 GFP Spectinomycin PMID:30633862 Vector Backbone:pSC101; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:03:42 1
pROP-IP-FBFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_122138 FBFP Spectinomycin PMID:30633862 Vector Backbone:pSC101; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:03:42 1
pRetroX-PTuner DD-M.EcoGII-v5-Telomeric repeat-binding-factor1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_122084 DD-linker-M.EcoGII-V5-TERF1 Homo sapiens Ampicillin PMID:30517874 Backbone Marker:Clontech; Backbone Size:5875; Vector Backbone:pRetroX-pTuner; Vector Types:Mammalian Expression, Bacterial Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:03:41 2
pRetroX-PTuner DD-linker-M.EcoGII-v5-Lamin B1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_122083 DD-linker-M.EcoGII-V5-LaminB1 Homo sapiens Ampicillin PMID:30517874 Backbone Marker:Clontech; Backbone Size:5875; Vector Backbone:pRetroX-pTuner; Vector Types:Mammalian Expression, Bacterial Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:03:41 3

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.