Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: DCAF 15
Vector Backbone Description: Backbone Size:6845; Vector Backbone:pAC8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31686031
Proper citation: RRID:Addgene_174479 Copy
Species: Synthetic
Genetic Insert: attP and 3xP3-GFP-SV40 BsaI cassette
Vector Backbone Description: Backbone Size:2961; Vector Backbone:pKSB-; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: attP site within the fluorescence marker cassette is to allow subsequent insertions of attB plasmids in the knock-in locus
Proper citation: RRID:Addgene_174534 Copy
Species: Synthetic
Genetic Insert: PUb-mTurquoise BsaI cassette
Vector Backbone Description: Backbone Size:2961; Vector Backbone:pKSB-; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: The added N-terminal NLS in mTurquoise does not work very well, fluorescence is mostly cytoplasmic
Proper citation: RRID:Addgene_174535 Copy
Species: Homo sapiens
Genetic Insert: SEPTIN2
Vector Backbone Description: Vector Backbone:pnEA-vH; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34237139
Proper citation: RRID:Addgene_174497 Copy
Species: Synthetic
Genetic Insert: 3xP3-GFP BsaI cassette
Vector Backbone Description: Backbone Size:2961; Vector Backbone:pKSB-; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: The Tub56D terminator was chosen as an alternative to SV40
Proper citation: RRID:Addgene_174531 Copy
Species: Synthetic
Genetic Insert: 3xP3-DsRed BsaI cassette
Vector Backbone Description: Backbone Size:2961; Vector Backbone:pKSB-; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_174532 Copy
Species: Synthetic
Genetic Insert: 3xP3-mTurquoise BsaI cassette
Vector Backbone Description: Backbone Size:2961; Vector Backbone:pKSB-; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_174533 Copy
Species: Homo sapiens
Genetic Insert: SEPTIN2
Vector Backbone Description: Vector Backbone:pnEA-vH; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34237139
Proper citation: RRID:Addgene_174491 Copy
Species: Homo sapiens
Genetic Insert: FECH with yeast HEM15 promoter and terminator
Vector Backbone Description: Backbone Size:5726; Vector Backbone:pRS426; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34517185
Comments: Please note: The plasmid contain 17 nucleotide discrepancies at N-terminus of the FEECH sequence compared to the depositor's provided sequence. The depositor noted that these differences do not affect the plasmid's function.
Proper citation: RRID:Addgene_174524 Copy
Species: Homo sapiens
Genetic Insert: DDA1
Vector Backbone Description: Backbone Size:6785; Vector Backbone:pAC8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31686031
Proper citation: RRID:Addgene_174480 Copy
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3730; Vector Backbone:pGL4.10; Vector Types:Enhancer reporter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34874265
Proper citation: RRID:Addgene_174669 Copy
Species: Synthetic
Genetic Insert: LUC2
Vector Backbone Description: Backbone Marker:VectorBuilder; Vector Backbone:pLV; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_174665 Copy
Species: Homo sapiens
Genetic Insert: Bnip3L RNAi
Vector Backbone Description: Backbone Size:6349; Vector Backbone:pSuper-retro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15607964
Comments: Target sequence: AACAGTTCCTGGGTGGAGCTA
Proper citation: RRID:Addgene_17468 Copy
Species: Staphylococcus aureus and Escherichia coli
Genetic Insert: Anti-HER2 affibody ZHER2:342 fused to mutated form of BirA, BirA*
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7382; Vector Backbone:pET301/NT-DEST; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36742360
Proper citation: RRID:Addgene_174692 Copy
Species: Homo sapiens
Genetic Insert: human CD19, antigen minigene
Vector Backbone Description: Vector Backbone:MP71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986
Proper citation: RRID:Addgene_174610 Copy
Genetic Insert: Constitutive expression of secreted murine IFN gamma
Vector Backbone Description: Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986
Proper citation: RRID:Addgene_174602 Copy
Species: Homo sapiens
Genetic Insert: ubiquitination sgRNA
Vector Backbone Description: Backbone Marker:Feng Zhang (Addgene plasmid # 52961); Vector Backbone:lentiCRISPR v2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31692446
Proper citation: RRID:Addgene_174592 Copy
Genetic Insert: GM-CSF
Vector Backbone Description: Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986
Proper citation: RRID:Addgene_174596 Copy
Species: Mus musculus
Genetic Insert: KIF1A(1-365)-GCN4-GFP-SSPB(micro)
Vector Backbone Description: Vector Backbone:B-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32328628
Comments: Internal plasmid ID: WN350
Proper citation: RRID:Addgene_174632 Copy
Vector Backbone Description: Vector Backbone:The plasmid is built using multiple fragments; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33608525
Proper citation: RRID:Addgene_174656 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
