Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pHY002_Strep_Avi_hsDCAF15 Resource Report Resource Website |
RRID:Addgene_174479 | DCAF 15 | Homo sapiens | Ampicillin | PMID:31686031 | Backbone Size:6845; Vector Backbone:pAC8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:40 | 0 | ||
|
pKSB- attP 3xP3-GFPsv40 GGGG AAGA Resource Report Resource Website |
RRID:Addgene_174534 | attP and 3xP3-GFP-SV40 BsaI cassette | Synthetic | Ampicillin | attP site within the fluorescence marker cassette is to allow subsequent insertions of attB plasmids in the knock-in locus | Backbone Size:2961; Vector Backbone:pKSB-; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:41 | 0 | ||
|
pKSB- PUb-NLSmTurqSV40 GGGG AAGA Resource Report Resource Website |
RRID:Addgene_174535 | PUb-mTurquoise BsaI cassette | Synthetic | Ampicillin | The added N-terminal NLS in mTurquoise does not work very well, fluorescence is mostly cytoplasmic | Backbone Size:2961; Vector Backbone:pKSB-; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:41 | 0 | ||
|
pnEA-vH_His-TEV-SEPT2_SEPT6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_174497 | SEPTIN2 | Homo sapiens | Ampicillin | PMID:34237139 | Vector Backbone:pnEA-vH; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:41 | 1 | ||
|
pKSB- 3xP3-GFPsv40 GGGG AAGA Resource Report Resource Website |
RRID:Addgene_174531 | 3xP3-GFP BsaI cassette | Synthetic | Ampicillin | The Tub56D terminator was chosen as an alternative to SV40 | Backbone Size:2961; Vector Backbone:pKSB-; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:41 | 0 | ||
|
pKSB- 3xP3-DsRedSV40 GGGG AAGA Resource Report Resource Website |
RRID:Addgene_174532 | 3xP3-DsRed BsaI cassette | Synthetic | Ampicillin | Backbone Size:2961; Vector Backbone:pKSB-; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:41 | 0 | |||
|
pKSB- 3xP3-mTurqSV40 GGGG AAGA Resource Report Resource Website |
RRID:Addgene_174533 | 3xP3-mTurquoise BsaI cassette | Synthetic | Ampicillin | Backbone Size:2961; Vector Backbone:pKSB-; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:41 | 0 | |||
|
pnEA-vH_His-TEV-SEPT2 Resource Report Resource Website |
RRID:Addgene_174491 | SEPTIN2 | Homo sapiens | Ampicillin | PMID:34237139 | Vector Backbone:pnEA-vH; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:40 | 0 | ||
|
pRS426-HsFECH Resource Report Resource Website |
RRID:Addgene_174524 | FECH with yeast HEM15 promoter and terminator | Homo sapiens | Ampicillin | PMID:34517185 | Please note: The plasmid contain 17 nucleotide discrepancies at N-terminus of the FEECH sequence compared to the depositor's provided sequence. The depositor noted that these differences do not affect the plasmid's function. | Backbone Size:5726; Vector Backbone:pRS426; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Lacks original mitochondrial targeting sequence (162 bp), which has been replaced with a 350 bp fragment that contains the S. cerevisiae ferrochelatase Hem15 promoter and targeting sequence. | 2026-08-15 01:10:41 | 0 |
|
pTF023_His_hsDDA1 Resource Report Resource Website |
RRID:Addgene_174480 | DDA1 | Homo sapiens | Ampicillin | PMID:31686031 | Backbone Size:6785; Vector Backbone:pAC8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:40 | 0 | ||
|
pSA293-CHEQ-seq Resource Report Resource Website 1+ mentions |
RRID:Addgene_174669 | Ampicillin | PMID:34874265 | Backbone Marker:Promega; Backbone Size:3730; Vector Backbone:pGL4.10; Vector Types:Enhancer reporter; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:42 | 1 | ||||
|
pLV[Expression]-mCherry:T2A:Hygro-EF1A>Luc2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_174665 | LUC2 | Synthetic | Ampicillin | Backbone Marker:VectorBuilder; Vector Backbone:pLV; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:42 | 3 | |||
|
Bnip3L RNAi pSuper-retro Resource Report Resource Website |
RRID:Addgene_17468 | Bnip3L RNAi | Homo sapiens | Ampicillin | PMID:15607964 | Target sequence: AACAGTTCCTGGGTGGAGCTA | Backbone Size:6349; Vector Backbone:pSuper-retro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:43 | 0 | |
|
Affibody HER2:243.BirA*-pET301/NT-DEST Resource Report Resource Website |
RRID:Addgene_174692 | Anti-HER2 affibody ZHER2:342 fused to mutated form of BirA, BirA* | Staphylococcus aureus and Escherichia coli | Ampicillin | PMID:36742360 | Backbone Marker:Invitrogen; Backbone Size:7382; Vector Backbone:pET301/NT-DEST; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | R118G mutation in BirA | 2026-08-15 01:10:43 | 0 | |
|
PB713B-pCMV-MITD-NeoMini-T2A-tCD19-WPRE Resource Report Resource Website |
RRID:Addgene_174610 | human CD19, antigen minigene | Homo sapiens | Ampicillin | PMID:34396986 | Vector Backbone:MP71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:42 | 0 | ||
|
pMP71-IFN-gamma Resource Report Resource Website |
RRID:Addgene_174602 | Constitutive expression of secreted murine IFN gamma | Ampicillin | PMID:34396986 | Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:42 | 0 | |||
|
Human ubiquitination-related proteins CRISPR KO library Resource Report Resource Website 1+ mentions |
RRID:Addgene_174592 | ubiquitination sgRNA | Homo sapiens | Ampicillin | PMID:31692446 | Backbone Marker:Feng Zhang (Addgene plasmid # 52961); Vector Backbone:lentiCRISPR v2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:42 | 1 | ||
|
pMP71-GM-CSF Resource Report Resource Website 1+ mentions |
RRID:Addgene_174596 | GM-CSF | Ampicillin | PMID:34396986 | Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:42 | 1 | |||
|
pB80-KIF1A(1-365)-GCN4-GFP-SSPB(micro) Resource Report Resource Website |
RRID:Addgene_174632 | KIF1A(1-365)-GCN4-GFP-SSPB(micro) | Mus musculus | Ampicillin | PMID:32328628 | Internal plasmid ID: WN350 | Vector Backbone:B-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | mmKIF1A(aa1-365): Pro202Ala; EGFP: Met1Del; SSPB:Arg73Gln | 2026-08-15 01:10:42 | 0 |
|
pBE48 Resource Report Resource Website |
RRID:Addgene_174656 | Ampicillin | PMID:33608525 | Vector Backbone:The plasmid is built using multiple fragments; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:42 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
