Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: satellite repeat sequence
Vector Backbone Description: Vector Backbone:p156RRLsinpptCAGPRE; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21901007
Proper citation: RRID:Addgene_41795 Copy
Genetic Insert: HIV-1 Gag/Pol and RRE sequences
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22612657
Proper citation: RRID:Addgene_41791 Copy
Genetic Insert: E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] dnaG.Q576A
Vector Backbone Description: Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22904085
Proper citation: RRID:Addgene_41700 Copy
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23287722
Comments: For additional information:
http://arep.med.harvard.edu/human_crispr/
Proper citation: RRID:Addgene_41815 Copy
Species: Homo sapiens
Genetic Insert: SOX2, KLF4
Vector Backbone Description: Backbone Size:9364; Vector Backbone:pCE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23193063
Proper citation: RRID:Addgene_41814 Copy
Genetic Insert: gRNA_AAVS1-T2
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23287722
Comments: gRNA target sequence GGGGCCACTAGGGACAGGAT
Proper citation: RRID:Addgene_41818 Copy
Genetic Insert: gRNA_AAVS1-T1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23287722
Comments: gRNA target sequence GTCCCCTCCACCCCACAGTG
Proper citation: RRID:Addgene_41817 Copy
Species: Homo sapiens
Genetic Insert: Halotag 2
Vector Backbone Description: Backbone Marker:INVITROGEN; Backbone Size:5000; Vector Backbone:PCDNA5; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21725302
Comments: Alternate plasmid name: pCDNA5-KGH2
Proper citation: RRID:Addgene_41742 Copy
Genetic Insert: E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] xonA-, recJ-,xseA-, exoX- and redα- dnaG.Q576A tolC-
Vector Backbone Description: Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22904085
Proper citation: RRID:Addgene_41699 Copy
Species: Mus musculus
Genetic Insert: Notch-1 Intracellular Domain
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9620803
Comments: Alternate plasmid name: pCS2 NICv1744-6MT
To create pCS2+ NICV1744, the primer CCAGGATCCACCATGGTGCTGCTGTCCCGCAAGC was used with primer M95 (5'-TCGAACATTGACATCCATGCA-3') to generate a product that was digested with Bam HI and Bcl I, and ligated into the same sites in NΔE (Addgene plasmid #41737).
Proper citation: RRID:Addgene_41730 Copy
Species: Pyrococcus horikoshii
Genetic Insert: PhoCDC21-1 intein
Vector Backbone Description: Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22001202
Proper citation: RRID:Addgene_41695 Copy
Species: Homo sapiens
Genetic Insert: BRCA1
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10550055
Comments: The BRCA1 insert in this plasmid contains the following common polymorphisms when compared to GenBank reference sequence NP_009225.1: P871L, E1038G, K1182R, and S1613G. These SNPs were likely present in the original cDNA isolate.
Proper citation: RRID:Addgene_41968 Copy
Species: Synthetic
Genetic Insert: 4-4-20
Vector Backbone Description: Backbone Size:6142; Vector Backbone:pCT; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15465055
Proper citation: RRID:Addgene_41845 Copy
Species: Synthetic
Genetic Insert: 4M5.3
Vector Backbone Description: Backbone Size:6142; Vector Backbone:pCT; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15465055
Proper citation: RRID:Addgene_41844 Copy
Genetic Insert: DsRed
Vector Backbone Description: Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18988847
Comments: 24 hour half life EGFP
Proper citation: RRID:Addgene_41944 Copy
Genetic Insert: DsRed
Vector Backbone Description: Backbone Size:7556; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18988847
Comments: 1 hour half life EGFP
Proper citation: RRID:Addgene_41942 Copy
Species: Homo sapiens
Genetic Insert: ubiquitin specific peptidase 28
Vector Backbone Description: Backbone Size:4261; Vector Backbone:phCMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16901786
Proper citation: RRID:Addgene_41948 Copy
Vector Backbone Description: Backbone Marker:Susan Lindquist (Addgene plasmid# 14140); Backbone Size:6972; Vector Backbone:pAG306GPD-ccdB; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:23172144
Comments: This plasmid was generated by ligation of a SmaI-digested fusion PCR product that contained two ~500-base-pair regions of chromosome 1 flanking a NotI site into AatII-digested pAG306-GPD-ccdB.
Proper citation: RRID:Addgene_41894 Copy
Species: Homo sapiens
Genetic Insert: BRD7
Vector Backbone Description: Backbone Size:7556; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20660729
Proper citation: RRID:Addgene_41927 Copy
Species: Homo sapiens
Genetic Insert: CUL2
Vector Backbone Description: Backbone Size:8000; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21963094
Proper citation: RRID:Addgene_41912 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.