Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Phaeodactylum tricornutum
Genetic Insert: TALEN Backbone
Vector Backbone Description: Backbone Marker:GenBank_NCBI: AF219942; Backbone Size:3860; Vector Backbone:pPha-T1; Vector Types:Phaeodactylum tricornutum; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: N.E. Sanjana, L. Cong, Y. Zhou, M.M. Cunniff, G. Feng, F. Zhang
A transcription activator-like effector toolbox for genome engineering
Nat. Protoc., 7 (2012), pp. 171–192
Proper citation: RRID:Addgene_90416 Copy
Species: Phaeodactylum tricornutum
Genetic Insert: TALEN Backbone
Vector Backbone Description: Backbone Marker:GenBank_NCBI: JN180663; Backbone Size:3860; Vector Backbone:pPha-NR; Vector Types:Phaeodactylum tricornutum; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: N.E. Sanjana, L. Cong, Y. Zhou, M.M. Cunniff, G. Feng, F. Zhang
A transcription activator-like effector toolbox for genome engineering
Nat. Protoc., 7 (2012), pp. 171–192
Proper citation: RRID:Addgene_90422 Copy
Species: Phaeodactylum tricornutum
Genetic Insert: TALEN Backbone
Vector Backbone Description: Backbone Marker:GenBank_NCBI: AF219942; Backbone Size:3860; Vector Backbone:pPha-T1; Vector Types:Phaeodactylum tricornutum; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: N.E. Sanjana, L. Cong, Y. Zhou, M.M. Cunniff, G. Feng, F. Zhang
A transcription activator-like effector toolbox for genome engineering
Nat. Protoc., 7 (2012), pp. 171–192
Proper citation: RRID:Addgene_90420 Copy
Vector Backbone Description: Backbone Marker:Addgene plasmid 19780; Backbone Size:9600; Vector Backbone:FUdeltaGW-rtTA; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22174877
Comments: The MAP2-GFP lentiviral reporter plasmid pGZ-hMAP2 was purchased from System Biosciences (SR10047PA-1). The MAP2 promoter sequence from this plasmid was then cloned along with the Gateway cassette of pEF-DEST51 into the backbone of FUdeltaGW-rtTA (Addgene plasmid 19780) following removal of the ubiquitin promoter-rtTA sequence to produce FU-MAP2-Gateway.
Proper citation: RRID:Addgene_43915 Copy
Species: Drosophila melanogaster
Genetic Insert: Minimal Mos1, PuroR, [4-3] Gateway
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4070; Vector Backbone:pDESTR4-R3; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24820376
Proper citation: RRID:Addgene_44474 Copy
Species: Drosophila melanogaster
Genetic Insert: Minimal Mos1, unc-119, peel-1, [4-3] Gateway
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4070; Vector Backbone:pDESTR4-R3; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24820376
Proper citation: RRID:Addgene_44476 Copy
Species: Drosophila melanogaster
Genetic Insert: Minimal Mos1, PuroR, peel-1, [4-3] Gateway
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4070; Vector Backbone:pDESTR4-R3; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24820376
Proper citation: RRID:Addgene_44475 Copy
Species: Drosophila melanogaster
Genetic Insert: Minimal Mos1, [4-3] Gateway
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4070; Vector Backbone:pDESTR4-R3; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24820376
Proper citation: RRID:Addgene_44478 Copy
Vector Backbone Description: Vector Backbone:various; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:23124327
Comments: Note that there are a few small discrepancies between Addgene's quality control sequence and the depositor's full sequence. These differences do not affect any functional elements.
Proper citation: RRID:Addgene_44987 Copy
Genetic Insert: FRT-cat-FRT
Vector Backbone Description: Backbone Marker:M. Koob (University of Wisconsin, Madison); Vector Backbone:pANTSγ; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:10829079
Comments: This is a template plasmids for frt-flanked cat cassette. The cat cassette originally came from pSC140.
pKD3 and pKD4 are identical except for the region between the FRT sites, so they create an identical scar that has stop codons in all six reading frames. As drawn in the map, this scar has an idealized ribosome binding site and start codon for downstream (rightward) gene expression.
Proper citation: RRID:Addgene_45604 Copy
Vector Backbone Description: Vector Backbone:FUdeltaGW-rtTA; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:23591016
Comments: Please note that Addgene's sequencing results identified nucleotide mismatches at bp# 3473, 3937, 4087 & 4822 when compared to the full plasmid sequence. According to the depositing laboratory, these differences are not a concern for the function of the plasmid.
Proper citation: RRID:Addgene_46026 Copy
Vector Backbone Description: Backbone Size:8235; Vector Backbone:pCLX-DEST; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21590398
Comments: More information can be found at http://medweb2.unige.ch/salmon/lentilab/lentivectors.html
Proper citation: RRID:Addgene_45956 Copy
Vector Backbone Description: Backbone Size:11023; Vector Backbone:pCWX-DEST-PGR; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21761975
Comments: More information can be found at http://medweb2.unige.ch/salmon/lentilab/lentivectors.html
NOTE: there is an additional BglII site directly after the stop codon that is not present in the full depositor sequence.
Proper citation: RRID:Addgene_45953 Copy
Vector Backbone Description: Backbone Marker:Root Lab, Addgene; Backbone Size:9396; Vector Backbone:pLIX_403 (Addgene 41395); Vector Types:Mammalian Expression, Lentiviral, Gateway Destination vector, Doxycycline inducible; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:33963355
Proper citation: RRID:Addgene_183901 Copy
Vector Backbone Description: Backbone Marker:PMID: 7720076; Backbone Size:4885; Vector Backbone:injection vector pRN3; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. The injection vector pRN3 was modified to give rise to pSPE3 by inserting a new polylinker EcoR1-Stu1-Pme1-EcoRV-Not1 (GAATTCAGGCCTTTGTTTAAACTTAGATATCGCGGCCGC) between the EcoR1 and Not1 sites.
Proper citation: RRID:Addgene_186370 Copy
Vector Backbone Description: Backbone Size:5577; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mScarlet-I tag at Bgl II/Stu I restriction site
Proper citation: RRID:Addgene_186383 Copy
Vector Backbone Description: Backbone Size:5583; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mClover3 tag at EcoR V/Avr II restriction site
Proper citation: RRID:Addgene_186389 Copy
Vector Backbone Description: Backbone Size:5796; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal emiRFP703 tag at EcoR V/Avr II restriction site
Proper citation: RRID:Addgene_186386 Copy
Vector Backbone Description: Backbone Size:5427; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal Snap-tag tag at Bgl II/Stu I restriction site
Proper citation: RRID:Addgene_186385 Copy
Vector Backbone Description: Backbone Size:5598; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mVenus tag at Bgl II/Stu I restriction site
Proper citation: RRID:Addgene_186384 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
