Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

328,858 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pDTFendoNA2
 
Resource Report
Resource Website 		RRID:Addgene_174731 DT386F Corynebacterium diphtheriae Ampicillin PMID:34315766 This plasmid can be amplified and maintained in ampicillin-sensitive E. coli strains that harbor the lacIq mutation (such as XL1 Blue and JM109) or carries the pREP4 repressor plasmid (such as M15 [pREP4]). Backbone Marker:Finne lab; Backbone Size:7102; Vector Backbone:pFEndoNA2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Deleted amino acids 412-560 (the receptor binding domain R of diphtheria toxin) and added the furin protease cleavage motif RVRR. 2026-08-15 01:10:43 0
pFEndoNA
 
Resource Report
Resource Website 		RRID:Addgene_174724 GFP-endoNA fusion protein Aequorea victoria, Yersinia enterocolitica, Escherichia phage PK1A Ampicillin PMID:15627620 This plasmid can be amplified and maintained in ampicillin-sensitive E. coli strains that harbor the lacIq mutation (such as XL1 Blue and JM109) or carries the pREP4 repressor plasmid (such as M15 [pREP4]). Backbone Marker:QIAGEN; Backbone Size:3463; Vector Backbone:pQE-31; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:10:43 0
pDsEndoNA2
 
Resource Report
Resource Website 		RRID:Addgene_174728 DsRed-Monomer Discosoma sp. Ampicillin PMID:29203765 This plasmid can be amplified and maintained in ampicillin-sensitive E. coli strains that harbor the lacIq mutation (such as XL1 Blue and JM109) or carries the pREP4 repressor plasmid (such as M15 [pREP4]). Backbone Marker:Finne lab; Backbone Size:7102; Vector Backbone:pFEndoNA2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:10:43 0
pPRIChp-hOtub1
 
Resource Report
Resource Website 		RRID:Addgene_174743 OTUB1 Homo sapiens Ampicillin PMID:31182807 Vector Backbone:pPRIChp; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:10:43 0
pMIGR1-HA-mTBK1
 
Resource Report
Resource Website 		RRID:Addgene_174741 TBK1 Mus musculus Ampicillin Vector Backbone:pMIGR1; Vector Types:Retroviral; Bacterial Resistance:Ampicillin WT 2026-08-15 01:10:43 0
pLenti X2 Neo/pTER shEGFP#1 (w21-2)
 
Resource Report
Resource Website 		RRID:Addgene_17479 Enhanced green fluorescent protein shRNA #1 Ampicillin PMID:19657394 shRNA oligo sequence - CGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTCTTTTT Backbone Size:7919; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:10:44 0
pLenti CMV/TO Puro empty (w175-1)
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_17482 Ampicillin PMID:19657394 Backbone Size:8007; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:10:44 18
KM-CashGem-Xyl2-URA3-LINEAR
 
Resource Report
Resource Website 		RRID:Addgene_174838 Codon optimized Cas9:hGem Synthetic Ampicillin PMID:34711982 Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:10:44 0
pCS105
 
Resource Report
Resource Website 		RRID:Addgene_174830 11R Unique Saccharomyces cerevisiae Ampicillin PMID:34702734 Backbone Marker:ThermoFisher; Backbone Size:3956; Vector Backbone:pCR2.1-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Changing TEL11R to a unique end 2026-08-15 01:10:44 0
pPC1000
 
Resource Report
Resource Website 		RRID:Addgene_174829 CRISPRi SpCas9 sgRNA cassette Synthetic Ampicillin PMID:34653350 Vector Backbone:Lentiviral; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin Detailed in manuscript 2026-08-15 01:10:44 0
HEK3_pegR_18bp
 
Resource Report
Resource Website 		RRID:Addgene_174853 HEK3_pegR_18bp Synthetic Ampicillin PMID:34650270 Vector Backbone:pU6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:10:44 0
HEK3_pegR_44bp
 
Resource Report
Resource Website 		RRID:Addgene_174855 HEK3_pegR_44bp insertion Synthetic Ampicillin PMID:34650270 Vector Backbone:pU6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:10:44 0
HEK3_pegF_18bp
 
Resource Report
Resource Website 		RRID:Addgene_174852 HEK3_pegF_18bp insertion Synthetic Ampicillin PMID:34650270 Vector Backbone:pU6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:10:44 0
pLV-H1-SGINX
 
Resource Report
Resource Website 		RRID:Addgene_174844 Ampicillin Backbone Marker:Modified from pGIPZ; Backbone Size:9115; Vector Backbone:pLV-H1-SGINX; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:10:44 0
pLentiCRISPRv2 sgSp1
 
Resource Report
Resource Website 		RRID:Addgene_174907 Specificity Protein 1 Homo sapiens Ampicillin PMID:33730584 Backbone Marker:Addgene; Backbone Size:14873; Vector Backbone:pLentiCRISPRv2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Missense mutation to mutate PAM sequence 2026-08-15 01:10:45 0
pCMV-Mm.cargo(Cre)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_174862 Cre flanked by MmPeg10 UTRs Mus musculus Ampicillin PMID:34413232 Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:10:45 1
pCMV-Hs.cargo(Cre)
 
Resource Report
Resource Website 		RRID:Addgene_174863 Cre flanked by HsPeg10 UTRs Homo sapiens Ampicillin PMID:34413232 Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:10:45 0
pAS_8xMmaPylT_EF1_FLAG-MmaPylRS
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_174890 Mma PylRS Methanosarcina mazei Ampicillin PMID:34431592 Backbone Marker:Addgene #140008 based on PB510B-1 (System Bioscience); Vector Backbone:pAS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin U25C PylT 2026-08-15 01:10:45 1
pQCXIP X2/pTER shLUC (w454-1)
 
Resource Report
Resource Website 		RRID:Addgene_17491 Firefly Luciferase shRNA Ampicillin PMID:19657394 shRNA oligo sequence - 5'-CCTTACGCTGAGTACTTCGAGTGTGCTGTCCTCGAAGTACTCAGCGTAAGTTT Backbone Marker:Clontech; Backbone Size:7602; Vector Backbone:pQCXIP; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:10:45 0
pLenti CMV TetR Blast (716-1)
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_17492 Tetracycline repressor Ampicillin PMID:19657394 Backbone Size:8477; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:10:45 50

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch