Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Corynebacterium diphtheriae
Genetic Insert: DT386F
Vector Backbone Description: Backbone Marker:Finne lab; Backbone Size:7102; Vector Backbone:pFEndoNA2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34315766
Comments: This plasmid can be amplified and maintained in ampicillin-sensitive E. coli strains that harbor the lacIq mutation (such as XL1 Blue and JM109) or carries the pREP4 repressor plasmid (such as M15 [pREP4]).
Proper citation: RRID:Addgene_174731 Copy
Species: Aequorea victoria, Yersinia enterocolitica, Escherichia phage PK1A
Genetic Insert: GFP-endoNA fusion protein
Vector Backbone Description: Backbone Marker:QIAGEN; Backbone Size:3463; Vector Backbone:pQE-31; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15627620
Comments: This plasmid can be amplified and maintained in ampicillin-sensitive E. coli strains that harbor the lacIq mutation (such as XL1 Blue and JM109) or carries the pREP4 repressor plasmid (such as M15 [pREP4]).
Proper citation: RRID:Addgene_174724 Copy
Species: Discosoma sp.
Genetic Insert: DsRed-Monomer
Vector Backbone Description: Backbone Marker:Finne lab; Backbone Size:7102; Vector Backbone:pFEndoNA2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29203765
Comments: This plasmid can be amplified and maintained in ampicillin-sensitive E. coli strains that harbor the lacIq mutation (such as XL1 Blue and JM109) or carries the pREP4 repressor plasmid (such as M15 [pREP4]).
Proper citation: RRID:Addgene_174728 Copy
Species: Homo sapiens
Genetic Insert: OTUB1
Vector Backbone Description: Vector Backbone:pPRIChp; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31182807
Proper citation: RRID:Addgene_174743 Copy
Species: Mus musculus
Genetic Insert: TBK1
Vector Backbone Description: Vector Backbone:pMIGR1; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_174741 Copy
Genetic Insert: Enhanced green fluorescent protein shRNA #1
Vector Backbone Description: Backbone Size:7919; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Comments: shRNA oligo sequence - CGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTCTTTTT
Proper citation: RRID:Addgene_17479 Copy
Vector Backbone Description: Backbone Size:8007; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_17482 Copy
Species: Synthetic
Genetic Insert: Codon optimized Cas9:hGem
Vector Backbone Description: Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34711982
Proper citation: RRID:Addgene_174838 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 11R Unique
Vector Backbone Description: Backbone Marker:ThermoFisher; Backbone Size:3956; Vector Backbone:pCR2.1-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34702734
Proper citation: RRID:Addgene_174830 Copy
Species: Synthetic
Genetic Insert: CRISPRi SpCas9 sgRNA cassette
Vector Backbone Description: Vector Backbone:Lentiviral; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34653350
Proper citation: RRID:Addgene_174829 Copy
Species: Synthetic
Genetic Insert: HEK3_pegR_18bp
Vector Backbone Description: Vector Backbone:pU6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34650270
Proper citation: RRID:Addgene_174853 Copy
Species: Synthetic
Genetic Insert: HEK3_pegR_44bp insertion
Vector Backbone Description: Vector Backbone:pU6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34650270
Proper citation: RRID:Addgene_174855 Copy
Species: Synthetic
Genetic Insert: HEK3_pegF_18bp insertion
Vector Backbone Description: Vector Backbone:pU6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34650270
Proper citation: RRID:Addgene_174852 Copy
Vector Backbone Description: Backbone Marker:Modified from pGIPZ; Backbone Size:9115; Vector Backbone:pLV-H1-SGINX; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_174844 Copy
Species: Homo sapiens
Genetic Insert: Specificity Protein 1
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:14873; Vector Backbone:pLentiCRISPRv2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33730584
Proper citation: RRID:Addgene_174907 Copy
Species: Mus musculus
Genetic Insert: Cre flanked by MmPeg10 UTRs
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34413232
Proper citation: RRID:Addgene_174862 Copy
Species: Homo sapiens
Genetic Insert: Cre flanked by HsPeg10 UTRs
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34413232
Proper citation: RRID:Addgene_174863 Copy
Species: Methanosarcina mazei
Genetic Insert: Mma PylRS
Vector Backbone Description: Backbone Marker:Addgene #140008 based on PB510B-1 (System Bioscience); Vector Backbone:pAS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34431592
Proper citation: RRID:Addgene_174890 Copy
Genetic Insert: Firefly Luciferase shRNA
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7602; Vector Backbone:pQCXIP; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Comments: shRNA oligo sequence - 5'-CCTTACGCTGAGTACTTCGAGTGTGCTGTCCTCGAAGTACTCAGCGTAAGTTT
Proper citation: RRID:Addgene_17491 Copy
Genetic Insert: Tetracycline repressor
Vector Backbone Description: Backbone Size:8477; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_17492 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
