Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pAM-35s-Slah3-YFPn-1
 
Resource Report
Resource Website 		RRID:Addgene_102385 SLAH3 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
pAM-35s-Lyk5-YFPc-1
 
Resource Report
Resource Website 		RRID:Addgene_102386 LYK5 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
BL21ΔABC
 
Resource Report
Resource Website 		RRID:Addgene_102266 None PMID:29164072 Genotype = ΔompA ΔlamB ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-08-15 01:00:23 0
pAM-35s-CIPK5-YFPc-1
 
Resource Report
Resource Website 		RRID:Addgene_102387 CIPK5 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 0
pLJC5-Flag-SAMTOR
 
Resource Report
Resource Website 		RRID:Addgene_102420 SAMTOR Homo sapiens Ampicillin PMID:29123071 Vector Backbone:pLJC5; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 0
pTRE2-Bla(HA–RILP)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102425 Rab interacting lysosomal protein Homo sapiens Ampicillin PMID:27791088 Backbone Size:4858; Vector Backbone:pTre2-Bla; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 1
BL21ΔABF
 
Resource Report
Resource Website 		RRID:Addgene_102267 None PMID:29164072 Genotype = ΔompA ΔlamB ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-08-15 01:00:23 0
pPB-tetO(hCMV1)-HA-Tet1(201R2)-IV
 
Resource Report
Resource Website 		RRID:Addgene_102421 Tet1 Mus musculus Ampicillin PMID:28504700 The full length transcript 201 refers to the coding sequence (CDS) of Ensembl transcript Tet1-201 (transcript ID ENSMUST00000050826.13) or NCBI RefSeq NM_027384.1. This variant (isoform 2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, but the protein product retains catalytic function. Backbone Marker:Austin Smith (Addgene plasmid# 60432); Vector Backbone:pPB-hCMV1-hNANOG-IV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Modified at the Dharmacon SMARTpool siRNA #2 target site to make it siRNA-resistant 2026-08-15 01:00:23 0
pAM-35s-Lyk5-YFPn-1
 
Resource Report
Resource Website 		RRID:Addgene_102389 LYK5 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
pPB-tetO(hCMV1)-HA-Tet1mHxD(201R2)-IV
 
Resource Report
Resource Website 		RRID:Addgene_102422 Tet1 catalytic domain mutant Mus musculus Ampicillin PMID:28504700 The full length transcript 201 refers to the coding sequence (CDS) of Ensembl transcript Tet1-201 (transcript ID ENSMUST00000050826.13) or NCBI RefSeq NM_027384.1. This variant (isoform 2) lacks an alternate in-frame exon in the central coding region, compared to variant 1. Backbone Marker:Austin Smith (Addgene plasmid# 60432); Vector Backbone:pPB-hCMV1-hNANOG-IV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin H1620Y and D1622A mutations in Tet1 catalytic domain; Modified at the Dharmacon SMARTpool siRNA #2 target site to make it siRNA-resistant 2026-08-15 01:00:23 0
pPB-CAG-rtTA-IRES-Hygro
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_102423 tetracyclin-transactivator (rtTA) Ampicillin PMID:28504700 IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers: Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG Backbone Marker:Austin Smith lab; Vector Backbone:pPBCAG-rtTAM2-IN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 10
pET-28c(+)-YTHDF2
 
Resource Report
Resource Website 		RRID:Addgene_102275 YTHDF2 Homo sapiens Kanamycin PMID:27602518 Backbone Marker:Novagen; Vector Backbone:pET-28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:00:23 0
pAM-35s-CBL5-YFPc-1
 
Resource Report
Resource Website 		RRID:Addgene_102397 CBL5 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 0
pAM-35s-CBL6-YFPc-1
 
Resource Report
Resource Website 		RRID:Addgene_102398 CBL6 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
pAM-35s-Snrk2.3-YFPn-1
 
Resource Report
Resource Website 		RRID:Addgene_102391 SNRK2.3 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
pAM-35s-CBL2-YFPc-1
 
Resource Report
Resource Website 		RRID:Addgene_102394 CBL2 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
pLentiCRISPR sgHAL
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102315 sgHAL Homo sapiens Ampicillin PMID:29995852 Vector Backbone:pLentiCRISPR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 2
pTR47m4-GFP
 
Resource Report
Resource Website 		RRID:Addgene_102436 Formaldehyde repressor protein (frmR) E. coli Ampicillin PMID:28921510 Vector Backbone:pTR47m4; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 0
p2lox-cAMPr R626A
 
Resource Report
Resource Website 		RRID:Addgene_102437 cAMPr Ampicillin PMID:29511120 Backbone Size:3300; Vector Backbone:P2lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin PKA-R R626A 2026-08-15 01:00:24 0
pWP1_mFTCD
 
Resource Report
Resource Website 		RRID:Addgene_102317 Ftcd Mus musculus Ampicillin PMID:29995852 Vector Backbone:pWP1; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch