Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 312 showing 6221 ~ 6240 out of 12,972 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/61292

Species: Mus musculus
Genetic Insert: IL-6 promoter
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12626566
Comments: Contains point mutations in both AP-1 and C/EBP binding sites. See Table 1 of associated publication for more details. Full sequence and map is available for wild-type vector pmIL-6 FL (Plasmid #61290)

Proper citation: RRID:Addgene_61292 Copy   


  • RRID:Addgene_60939

    This resource has 10+ mentions.

http://www.addgene.org/60939

Species: Mus musculus
Genetic Insert: Ten-Eleven Translocation 2
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3*; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24412366
Comments: *modified pcDNA3 vector with a beta globulin intron inserted. This insertion can help stabilize the transcripts and is particularly useful for the expression of large genes, such as p300 and Tet proteins

Proper citation: RRID:Addgene_60939 Copy   


  • RRID:Addgene_60940

    This resource has 1+ mentions.

http://www.addgene.org/60940

Species: Mus musculus
Genetic Insert: Ten-Eleven Translocation 3
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pcDNA-flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24412366

Proper citation: RRID:Addgene_60940 Copy   


  • RRID:Addgene_61286

    This resource has 1+ mentions.

http://www.addgene.org/61286

Species: Mus musculus
Genetic Insert: IL-6 promoter
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12626566

Proper citation: RRID:Addgene_61286 Copy   


  • RRID:Addgene_61867

http://www.addgene.org/61867

Species: Mus musculus
Genetic Insert: Sesn1
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25259925

Proper citation: RRID:Addgene_61867 Copy   


  • RRID:Addgene_61868

http://www.addgene.org/61868

Species: Mus musculus
Genetic Insert: Sesn2
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25259925

Proper citation: RRID:Addgene_61868 Copy   


http://www.addgene.org/61514

Species: Mus musculus
Genetic Insert: gccgctcccggatctcctgc
Vector Backbone Description: Vector Backbone:px335; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25569111

Proper citation: RRID:Addgene_61514 Copy   


http://www.addgene.org/61831

Species: Mus musculus
Genetic Insert: Zscan4d
Vector Backbone Description: Backbone Size:5700; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25417163

Proper citation: RRID:Addgene_61831 Copy   


  • RRID:Addgene_61684

    This resource has 1+ mentions.

http://www.addgene.org/61684

Species: Mus musculus
Genetic Insert: IFT88
Vector Backbone Description: Vector Backbone:pEF5-FRT-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23930224

Proper citation: RRID:Addgene_61684 Copy   


  • RRID:Addgene_62738

http://www.addgene.org/62738

Species: Mus musculus
Genetic Insert: Talin
Vector Backbone Description: Vector Backbone:C1 Cloning Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_62738 Copy   


  • RRID:Addgene_62351

http://www.addgene.org/62351

Species: Mus musculus
Genetic Insert: TK-Hyg-24xMS2
Vector Backbone Description: Backbone Size:6395; Vector Backbone:pBlueScript II SK (+); Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26092696

Proper citation: RRID:Addgene_62351 Copy   


  • RRID:Addgene_63881

    This resource has 1+ mentions.

http://www.addgene.org/63881

Species: Mus musculus
Genetic Insert: Tet1 promoter fragment A
Vector Backbone Description: Backbone Size:4807; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25582196

Proper citation: RRID:Addgene_63881 Copy   


  • RRID:Addgene_63882

http://www.addgene.org/63882

Species: Mus musculus
Genetic Insert: Tet1 promoter fragment B
Vector Backbone Description: Backbone Size:4807; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25582196

Proper citation: RRID:Addgene_63882 Copy   


http://www.addgene.org/63880

Species: Mus musculus
Genetic Insert: Tet1 enhancer fragment E
Vector Backbone Description: Backbone Size:5005; Vector Backbone:pGL3-Promoter; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25582196

Proper citation: RRID:Addgene_63880 Copy   


http://www.addgene.org/62977

Species: Mus musculus
Genetic Insert: BTRC
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25632159

Proper citation: RRID:Addgene_62977 Copy   


  • RRID:Addgene_63676

    This resource has 1+ mentions.

http://www.addgene.org/63676

Species: Mus musculus
Genetic Insert: HDAC3
Vector Backbone Description: Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16982804

Proper citation: RRID:Addgene_63676 Copy   


  • RRID:Addgene_63721

http://www.addgene.org/63721

Species: Mus musculus
Genetic Insert: BLBP
Vector Backbone Description: Backbone Size:1700; Vector Backbone:pCAG-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23345401

Proper citation: RRID:Addgene_63721 Copy   


  • RRID:Addgene_63569

    This resource has 1+ mentions.

http://www.addgene.org/63569

Species: Mus musculus
Genetic Insert: Bicaudal D protein
Vector Backbone Description: Backbone Size:7041; Vector Backbone:pBa-eGFP-FKBP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25624392
Comments: pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination. XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.

Proper citation: RRID:Addgene_63569 Copy   


  • RRID:Addgene_63177

    This resource has 1+ mentions.

http://www.addgene.org/63177

Species: Mus musculus
Genetic Insert: MarsL274G
Vector Backbone Description: Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26991063
Comments: Developed by Alborz Mahdavi.

Proper citation: RRID:Addgene_63177 Copy   


  • RRID:Addgene_64209

    This resource has 1+ mentions.

http://www.addgene.org/64209

Species: Mus musculus
Genetic Insert: Rab5a
Vector Backbone Description: Backbone Size:6280; Vector Backbone:pBa-FRB-3myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25624392
Comments: pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination. XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.

Proper citation: RRID:Addgene_64209 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X