Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,972 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pmIL-6 mut AP-1+C/EBP
 
Resource Report
Resource Website 		RRID:Addgene_61292 IL-6 promoter Mus musculus Ampicillin PMID:12626566 Contains point mutations in both AP-1 and C/EBP binding sites. See Table 1 of associated publication for more details. Full sequence and map is available for wild-type vector pmIL-6 FL (Plasmid #61290) Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin Mutated both AP-1 binding site from TGAGTCT to TGCAGCT and C/EBP binding site from ACATTGTGCAATCT to ACAGATATCAATCT 2026-08-25 09:24:24 0
pcDNA3-Tet2
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_60939 Ten-Eleven Translocation 2 Mus musculus Ampicillin PMID:24412366 *modified pcDNA3 vector with a beta globulin intron inserted. This insertion can help stabilize the transcripts and is particularly useful for the expression of large genes, such as p300 and Tet proteins Backbone Size:5400; Vector Backbone:pcDNA3*; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-25 09:24:22 10
pcDNA-Flag-Tet3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_60940 Ten-Eleven Translocation 3 Mus musculus Ampicillin PMID:24412366 Backbone Size:6000; Vector Backbone:pcDNA-flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-25 09:24:22 4
pmIL-6 FL
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61286 IL-6 promoter Mus musculus Ampicillin PMID:12626566 Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-25 09:24:24 8
pcDNA3.1 Flag-Sesn1b
 
Resource Report
Resource Website 		RRID:Addgene_61867 Sesn1 Mus musculus Ampicillin PMID:25259925 Backbone Size:6000; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin none 2026-08-25 09:24:28 0
pcDNA3.1 Flag-Sesn2
 
Resource Report
Resource Website 		RRID:Addgene_61868 Sesn2 Mus musculus Ampicillin PMID:25259925 Backbone Size:6000; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin none 2026-08-25 09:24:28 0
px335 Mettl14 sgRNA #2
 
Resource Report
Resource Website 		RRID:Addgene_61514 gccgctcccggatctcctgc Mus musculus Ampicillin PMID:25569111 Vector Backbone:px335; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-25 09:24:26 0
pcDNA-flag-mZscan4d-polyA
 
Resource Report
Resource Website 		RRID:Addgene_61831 Zscan4d Mus musculus Ampicillin PMID:25417163 Backbone Size:5700; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-25 09:24:28 0
pEF5-FRT-TagRFP-T-IFT88
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61684 IFT88 Mus musculus Ampicillin PMID:23930224 Vector Backbone:pEF5-FRT-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-25 09:24:27 4
mApple-Talin-C-18
 
Resource Report
Resource Website 		RRID:Addgene_62738 Talin Mus musculus Kanamycin Vector Backbone:C1 Cloning Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin none 2026-08-25 09:24:34 0
pTV-Oct4-TK-HMS
 
Resource Report
Resource Website 		RRID:Addgene_62351 TK-Hyg-24xMS2 Mus musculus Ampicillin PMID:26092696 Backbone Size:6395; Vector Backbone:pBlueScript II SK (+); Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin 2026-08-25 09:24:32 0
pGL3-Tet1 promoter A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_63881 Tet1 promoter fragment A Mus musculus Ampicillin PMID:25582196 Backbone Size:4807; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-25 09:24:42 1
pGL3-Tet1 promoter B
 
Resource Report
Resource Website 		RRID:Addgene_63882 Tet1 promoter fragment B Mus musculus Ampicillin PMID:25582196 Backbone Size:4807; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-25 09:24:42 0
pGL3-SV40P-Tet1 enhancer E
 
Resource Report
Resource Website 		RRID:Addgene_63880 Tet1 enhancer fragment E Mus musculus Ampicillin PMID:25582196 Backbone Size:5005; Vector Backbone:pGL3-Promoter; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-25 09:24:42 0
pcDNA3.1 myc-mβTrCP WD1-7 (241-569)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_62977 BTRC Mus musculus Ampicillin PMID:25632159 Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin codes for residues 241-569 2026-08-25 09:24:36 2
pCMV5-Flag-HDAC3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_63676 HDAC3 Mus musculus Ampicillin PMID:16982804 Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-25 09:24:40 2
BLBP-mCherry
 
Resource Report
Resource Website 		RRID:Addgene_63721 BLBP Mus musculus Ampicillin PMID:23345401 Backbone Size:1700; Vector Backbone:pCAG-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 1700 bp upstream of BLBP gene cloned in CAG-mCherry 2026-08-25 09:24:41 0
pBa-eGFP-flag-BicD2 594-FKBP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_63569 Bicaudal D protein Mus musculus Ampicillin PMID:25624392 pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination. XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains. Backbone Size:7041; Vector Backbone:pBa-eGFP-FKBP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin no start methionine, aa1-594 2026-08-25 09:24:40 2
pMarsL274G
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_63177 MarsL274G Mus musculus Ampicillin PMID:26991063 Developed by Alborz Mahdavi. Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin L274G 2026-08-25 09:24:37 2
pBa-FRB-3myc-Rab5a
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_64209 Rab5a Mus musculus Ampicillin PMID:25624392 pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination. XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains. Backbone Size:6280; Vector Backbone:pBa-FRB-3myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-25 09:24:44 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch