Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: H11-H4
Vector Backbone Description: Vector Backbone:pOPINO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32661423
Proper citation: RRID:Addgene_155364 Copy
Species: Homo sapiens
Genetic Insert: FOXC2
Vector Backbone Description: Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17537911
Proper citation: RRID:Addgene_15535 Copy
Species: Homo sapiens
Genetic Insert: Ash2L
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4972; Vector Backbone:pGEX-5X1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17500065
Comments: Full-length ASH2L cDNA was amplified by reverse transcription-PCR from HeLaS cells using primers 5'-TAT AGG ATC CTG GTG ATG GCG GCG GCA GGA G-3' and 5'-CAG CGA CTC GAG TCA GGG TTC CCA TGG GGG AC-3'.
Proper citation: RRID:Addgene_15549 Copy
Species: Homo sapiens
Genetic Insert: htt 103Q Delta Pro
Vector Backbone Description: Backbone Size:0; Vector Backbone:p303 Gal; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16832050
Comments: Figure 2, VI in article.
Lindquist lab number: 7704
Proper citation: RRID:Addgene_15579 Copy
Species: Homo sapiens
Genetic Insert: htt 103Q Delta Pro
Vector Backbone Description: Backbone Size:0; Vector Backbone:p303 Gal; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16832050
Comments: Figure 1C in article.
Lindquist lab number: 7720
Due to slippage when polymerases go through them, the Q stretches often get shorter over time due to mistakes while they are replicated in the cells. The shortening should not have much of an effect until the Q stretches get into the 80s.
Proper citation: RRID:Addgene_15587 Copy
Species: Homo sapiens
Genetic Insert: htt 25Q Delta Pro
Vector Backbone Description: Backbone Size:0; Vector Backbone:p303 Gal; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16832050
Comments: Figure 1C in article.
Lindquist lab number: 7719
Proper citation: RRID:Addgene_15584 Copy
Species: Homo sapiens
Genetic Insert: YTHDF1
Vector Backbone Description: Backbone Marker:New England Biolabs; Vector Backbone:pSNAPf; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32451507
Proper citation: RRID:Addgene_155346 Copy
Species: Homo sapiens
Genetic Insert: YTHDF2
Vector Backbone Description: Backbone Marker:New England Biolabs; Vector Backbone:pSNAPf; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32451507
Proper citation: RRID:Addgene_155347 Copy
Species: Synthetic
Genetic Insert: humanized EBpaRS/BstYam
Vector Backbone Description: Backbone Marker:Clontech, major modifications; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32929862
Comments: The plasmid has been developed for efficient incorporation of Bpa in mammalian cells, first reported in Böttke et al, EMBO reports, 2020. With respect to similar plasmids from other labs, this plasmid contains a humanized gene for EBpaRS and 4 copies of the U6-BstYam tRNA cassette downstream of the synthetase cassette.
Proper citation: RRID:Addgene_155342 Copy
Vector Backbone Description: Backbone Size:6866; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1997. Fire Lab Miniprep Number pPD115.60, Ligation number L3568.
Proper citation: RRID:Addgene_1560 Copy
Species: Mus musculus
Genetic Insert: M71 Targeting Vector
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBS; Vector Types:high copy number; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15186781
Proper citation: RRID:Addgene_15635 Copy
Species: Mus musculus
Genetic Insert: mouse SMC3
Vector Backbone Description: Vector Backbone:pKS037-pCAGGS-3XFLAG-Smc3-mKate2-bpAk; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33154377
Proper citation: RRID:Addgene_156447 Copy
Species: Homo sapiens
Genetic Insert: LAP2
Vector Backbone Description: Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959612
Comments: Human LAP2 was cloned by PCR from cDNA template and then digested with EcoR1/SalI and inserted in pBabe-Puro.
Proper citation: RRID:Addgene_15712 Copy
Species: Mus musculus
Genetic Insert: PRAS40 shRNA
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17510057
Comments: Oligonucleotides encoding the short-hairpin RNA expression cassette targeting mouse PRAS40 from base 753-773 (GI:124376717) were annealed and subcloned into pLKO.1. See author's map for shRNA sequence information.
Proper citation: RRID:Addgene_15672 Copy
Vector Backbone Description: Backbone Size:8081; Vector Backbone:pCM433; Vector Types:bacterial allelic exchange vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18710539
Comments: Ampicillin, Chloramphenicol, Tetracycline
Proper citation: RRID:Addgene_15670 Copy
Species: Homo sapiens
Genetic Insert: TIF1 gamma shRNA
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pRetrosuper-GFP; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16751102
Comments: shRNA oligos were first cloned into pRetrosuper-Puro digested with BglII and HindIII.
Next, the AgeI/XhoI fragments from shRNA sequence-containing pRetrosuper-Puro plasmids were cloned into the AgeI/XhoI site of pRetrosuper-GFP.
Sense oligo: 5'-gatcccc GAAGATGTCT CAGAGTCTG ttcaagaga CAGACTCTGA GACATCTTC tttttggaaa-3'.
Proper citation: RRID:Addgene_15721 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16894141
Comments: The human YAP ORF was cloned into the pBABEpuro vector as an EcoRI–BamHI fragment. A single FLAG tag was added to the N terminus during PCR with the following primers: Hs.YAP.F, CCGGGATCCACCATGGATTACAAGGATGACGACGATAAGATGGACCCCGGGCAGCAGCCCGCCGC; and Hs.YAP.R, CCGGAATTCCTATAACCATGTAAGAAAGCTTTC.
Proper citation: RRID:Addgene_15682 Copy
Species: Homo sapiens
Genetic Insert: TIF1 gamma shRNA
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pRetrosuper; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16751102
Comments: shRNA oligos were cloned into pRetrosuper-Puro digested with BglII and HindIII.
Sense oligo: 5'-gatcccc GAAGATGTCT CAGAGTCTG ttcaagaga CAGACTCTGA GACATCTTC tttttggaaa-3'.
Proper citation: RRID:Addgene_15728 Copy
Species: Rattus norvegicus
Genetic Insert: rApoI
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:29991261
Comments: Esherichia coli strain that expresses MutaT7, a fusion of rat APOBEC1 and the T7 RNA polymerase. Genotype: DH10B Δung ΔmotAB ΔcsgABCDEFG [PlacI<>Ptac] Δ(araA-leu)7697::[PA1lacO-Tenth MutaT7]
Proper citation: RRID:Addgene_156460 Copy
Species: Homo sapiens
Genetic Insert: Myc shRNA
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pRetrosuper; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17558397
Comments: hairpin targets the sequence: GATGAGGAAGAAATCGATG
Proper citation: RRID:Addgene_15662 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
