Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: CytERM-mRhubarb720
Vector Backbone Description: Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37666982
Comments: Please visit https://www.researchsquare.com/article/rs-797586/v1 for preprint.
Proper citation: RRID:Addgene_197191 Copy
Species: Mus musculus
Genetic Insert: Sema4d
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39152101
Proper citation: RRID:Addgene_190645 Copy
Species: Mus musculus
Genetic Insert: Mex3a
Vector Backbone Description: Vector Backbone:pTRE2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please note, this Mex3a construct conserves mus musculus Mex3a amino acids, but underlying DNA sequence has been modified to reduce CG content.
Proper citation: RRID:Addgene_223244 Copy
Species: Mus musculus
Genetic Insert: FLNA
Vector Backbone Description: Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38898113
Proper citation: RRID:Addgene_227876 Copy
Species: Mus musculus
Genetic Insert: Tent5a
Vector Backbone Description: Vector Backbone:pCDH_CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40421654
Proper citation: RRID:Addgene_221439 Copy
Species: Mus musculus
Genetic Insert: Ezrin
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2023.04.09.536178 for bioRxiv preprint.
Proper citation: RRID:Addgene_227682 Copy
Species: Mus musculus
Genetic Insert: Bromodomain-containing protein 4
Vector Backbone Description: Vector Backbone:pRSF-DUET1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:42128888
Proper citation: RRID:Addgene_257846 Copy
Species: Mus musculus
Genetic Insert: KMT2A/MLL1(4)
Vector Backbone Description: Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31980037
Comments: UniProt: Q03164 https://www.UniProt.org/UniProtkb/Q03164/entry
Proper citation: RRID:Addgene_259455 Copy
Species: Mus musculus
Genetic Insert: KMT2A/MLL1(1-3)
Vector Backbone Description: Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31980037
Comments: UniProt: Q03164 https://www.UniProt.org/UniProtkb/Q03164/entry
Proper citation: RRID:Addgene_259454 Copy
Species: Mus musculus
Genetic Insert: Aicda intron 1
Vector Backbone Description: Vector Backbone:pLH28; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:42335900
Proper citation: RRID:Addgene_259579 Copy
Species: Mus musculus
Genetic Insert: CD19
Vector Backbone Description: Vector Backbone:pINDUCER; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:42424437
Comments: Please note that the depositor's annotated reference file has minor differences compared to the Addgene verified sequence. Please refer to the the Addgene sequence for the most accurate result.
Proper citation: RRID:Addgene_259772 Copy
Species: Mus musculus
Genetic Insert: Mfn1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA3.1(-)/Myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12527753
Proper citation: RRID:Addgene_23212 Copy
Species: Mus musculus
Genetic Insert: IKK alpha
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9710600
Proper citation: RRID:Addgene_23296 Copy
Species: Mus musculus
Genetic Insert: IKK alpha
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9710600
Proper citation: RRID:Addgene_23297 Copy
Species: Mus musculus
Genetic Insert: Bim EL (TD)
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18498746
Proper citation: RRID:Addgene_23092 Copy
Species: Mus musculus
Genetic Insert: Bim EL (TA)
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18498746
Proper citation: RRID:Addgene_23093 Copy
Species: Mus musculus
Genetic Insert: c-src
Vector Backbone Description: Backbone Marker:Z Dominski and R Kole; Backbone Size:0; Vector Backbone:DUP33; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9343417
Comments: This clone was assembled from multiple PCR products by using the following
primers, described by their sequence relationship to the transcribed DUP RNA.
DUP1 (GCAGCTCACTCAGTGTGGCA) is complementary to CMV DUP33
exon 3 (globin exon 2). DUP2 (CCAATAGATCTGGGCATGTG) is homolo-
gous to CMV DUP33 intron 2 but with an inserted BglII site. DUP3 (CACAT
GCCCAGATCTATTGG) is complementary to intron 2 and to primer DUP2
and also contains the BglII site. DUP4 (GCTGCTGGTGGTGCCATGGC) is
homologous to CMV DUP33 exon 2. DUP5 (CTGCCCAGGGCCTGCCAT
GG) is complementary to CMV DUP33 exon 2 and to primer DUP4. DUP6
(TTCTGATAGGGCCCACTGACTCT) is homologous to CMV DUP33 intron
1 but contains an inserted ApaI site. DUP7 (AGAGTCAGTGGGCCCTATCA
GAA) also contains the ApaI site and is complementary to intron 1 and primer
DUP6. DUP8 (GACACCATGCATGGTGCACC) is homologous to DUP exon
1. A series of PCRs was performed with the following primers and templates.
Fragments of CMV DUP33 DNA were amplified by using primer pairs 1-2, 3-4,
5-6, and 7-8. The second set of PCRs used the following: primers 1 and 4 with the
1-2 and 3-4 PCR products as templates, and primers 5 and 8 with the 5-6 and 7-8
PCR products as templates. A final PCR assembled a complete fragment by
using primers 1 and 8 with the 1-4 and 5-8 PCR products as templates. This final
PCR product was cleaved with NsiI and DraIII and inserted into the CMV
DUP33 vector also cleaved with NsiI and DraIII. This clone was designated
DUP4-1.
Proper citation: RRID:Addgene_23022 Copy
Species: Mus musculus
Genetic Insert: Bim EL
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18498746
Proper citation: RRID:Addgene_23090 Copy
Species: Mus musculus
Genetic Insert: DLC2
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12591950
Proper citation: RRID:Addgene_24269 Copy
Species: Mus musculus
Genetic Insert: nAChR beta2 WT
Vector Backbone Description: Backbone Size:5472; Vector Backbone:pCIneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14684858
Proper citation: RRID:Addgene_24272 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
