Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCytERM-mRhubarb720-N1 Resource Report Resource Website |
RRID:Addgene_197191 | CytERM-mRhubarb720 | Mus musculus | Kanamycin | PMID:37666982 | Please visit https://www.researchsquare.com/article/rs-797586/v1 for preprint. | Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-25 09:14:29 | 0 | |
|
pCAG-sp-myc-mSema4D Resource Report Resource Website |
RRID:Addgene_190645 | Sema4d | Mus musculus | Ampicillin | PMID:39152101 | Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:13:41 | 0 | ||
|
pTRE2_CMV_Mex3a_t2a_mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_223244 | Mex3a | Mus musculus | Ampicillin | Please note, this Mex3a construct conserves mus musculus Mex3a amino acids, but underlying DNA sequence has been modified to reduce CG content. | Vector Backbone:pTRE2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | amino acids conserved, underlying DNA sequence reduced in CGs | 2026-08-25 09:17:35 | 1 | |
|
pcDNA 3.3 N-MYC FLNA Resource Report Resource Website |
RRID:Addgene_227876 | FLNA | Mus musculus | Ampicillin | PMID:38898113 | Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:18:03 | 0 | ||
|
FHpHG_mTent5a Resource Report Resource Website |
RRID:Addgene_221439 | Tent5a | Mus musculus | Ampicillin | PMID:40421654 | Vector Backbone:pCDH_CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:17:23 | 0 | ||
|
pZac2.1-GfaABC1D-Ezrin T567D-BioID2-HA Resource Report Resource Website |
RRID:Addgene_227682 | Ezrin | Mus musculus | Ampicillin | Please visit https://doi.org/10.1101/2023.04.09.536178 for bioRxiv preprint. | Vector Backbone:pZac2.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | T567D | 2026-08-25 09:18:02 | 0 | |
|
12x His-SUMO BRD4 (333-460) L387A + E438C "BromoCatch" from Homo Sapiens Resource Report Resource Website |
RRID:Addgene_257846 | Bromodomain-containing protein 4 | Mus musculus | Kanamycin | PMID:42128888 | Vector Backbone:pRSF-DUET1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Deleted amino acids 333-459 , Leucine 387 to Alanine, & Glutamic acid 483 to Cystine | 2026-08-25 09:20:45 | 0 | |
|
pGEX - KMT2A/MLL1(4) Resource Report Resource Website |
RRID:Addgene_259455 | KMT2A/MLL1(4) | Mus musculus | Ampicillin | PMID:31980037 | UniProt: Q03164 https://www.UniProt.org/UniProtkb/Q03164/entry | Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:20:50 | 0 | |
|
pGEX - KMT2A/MLL1(1-3) Resource Report Resource Website |
RRID:Addgene_259454 | KMT2A/MLL1(1-3) | Mus musculus | Ampicillin | PMID:31980037 | UniProt: Q03164 https://www.UniProt.org/UniProtkb/Q03164/entry | Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:20:50 | 0 | |
|
pLH260 Resource Report Resource Website |
RRID:Addgene_259579 | Aicda intron 1 | Mus musculus | Ampicillin | PMID:42335900 | Vector Backbone:pLH28; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-25 09:20:52 | 0 | ||
|
pINDUCER20-mCD19 Resource Report Resource Website |
RRID:Addgene_259772 | CD19 | Mus musculus | Ampicillin | PMID:42424437 | Please note that the depositor's annotated reference file has minor differences compared to the Addgene verified sequence. Please refer to the the Addgene sequence for the most accurate result. | Vector Backbone:pINDUCER; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-25 09:20:53 | 0 | |
|
Mfn1-Myc Resource Report Resource Website 10+ mentions |
RRID:Addgene_23212 | Mfn1 | Mus musculus | Ampicillin | PMID:12527753 | Backbone Size:5000; Vector Backbone:pcDNA3.1(-)/Myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:18:33 | 20 | ||
|
pcDNA-Ikka-HA WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_23296 | IKK alpha | Mus musculus | Ampicillin | PMID:9710600 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:18:39 | 2 | ||
|
pcDNA-Ikka-HA (K44M) Resource Report Resource Website 1+ mentions |
RRID:Addgene_23297 | IKK alpha | Mus musculus | Ampicillin | PMID:9710600 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | K44M | 2026-08-25 09:18:39 | 2 | |
|
pCMV-Tag2B Flag BimEL(TD) Resource Report Resource Website |
RRID:Addgene_23092 | Bim EL (TD) | Mus musculus | Kanamycin | PMID:18498746 | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Changed Threonine 112 to Aspartate | 2026-08-25 09:18:25 | 0 | |
|
pCMV-Tag2B Flag BimEL(TA) Resource Report Resource Website |
RRID:Addgene_23093 | Bim EL (TA) | Mus musculus | Kanamycin | PMID:18498746 | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Changed Threonine 112 to Alanine | 2026-08-25 09:18:25 | 0 | |
|
pDUP 4-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_23022 | c-src | Mus musculus | Ampicillin | PMID:9343417 | This clone was assembled from multiple PCR products by using the following primers, described by their sequence relationship to the transcribed DUP RNA. DUP1 (GCAGCTCACTCAGTGTGGCA) is complementary to CMV DUP33 exon 3 (globin exon 2). DUP2 (CCAATAGATCTGGGCATGTG) is homolo- gous to CMV DUP33 intron 2 but with an inserted BglII site. DUP3 (CACAT GCCCAGATCTATTGG) is complementary to intron 2 and to primer DUP2 and also contains the BglII site. DUP4 (GCTGCTGGTGGTGCCATGGC) is homologous to CMV DUP33 exon 2. DUP5 (CTGCCCAGGGCCTGCCAT GG) is complementary to CMV DUP33 exon 2 and to primer DUP4. DUP6 (TTCTGATAGGGCCCACTGACTCT) is homologous to CMV DUP33 intron 1 but contains an inserted ApaI site. DUP7 (AGAGTCAGTGGGCCCTATCA GAA) also contains the ApaI site and is complementary to intron 1 and primer DUP6. DUP8 (GACACCATGCATGGTGCACC) is homologous to DUP exon 1. A series of PCRs was performed with the following primers and templates. Fragments of CMV DUP33 DNA were amplified by using primer pairs 1-2, 3-4, 5-6, and 7-8. The second set of PCRs used the following: primers 1 and 4 with the 1-2 and 3-4 PCR products as templates, and primers 5 and 8 with the 5-6 and 7-8 PCR products as templates. A final PCR assembled a complete fragment by using primers 1 and 8 with the 1-4 and 5-8 PCR products as templates. This final PCR product was cleaved with NsiI and DraIII and inserted into the CMV DUP33 vector also cleaved with NsiI and DraIII. This clone was designated DUP4-1. | Backbone Marker:Z Dominski and R Kole; Backbone Size:0; Vector Backbone:DUP33; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:18:20 | 1 | |
|
pCMV-Tag2B Flag BimEL Resource Report Resource Website 1+ mentions |
RRID:Addgene_23090 | Bim EL | Mus musculus | Kanamycin | PMID:18498746 | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-25 09:18:25 | 1 | ||
|
pCDNA3 Flag DLC2 Resource Report Resource Website |
RRID:Addgene_24269 | DLC2 | Mus musculus | Ampicillin | PMID:12591950 | Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:19:35 | 0 | ||
|
nAChR beta2 WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_24272 | nAChR beta2 WT | Mus musculus | Ampicillin | PMID:14684858 | Backbone Size:5472; Vector Backbone:pCIneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:19:35 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
