Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 315 showing 6281 ~ 6300 out of 328,858 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_175323

http://www.addgene.org/175323

Species: Homo sapiens
Genetic Insert: CCDC86
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.

Proper citation: RRID:Addgene_175323 Copy   

    • RRID:Addgene_175325

http://www.addgene.org/175325

Species: Homo sapiens
Genetic Insert: HSPA8
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.

Proper citation: RRID:Addgene_175325 Copy   

    • RRID:Addgene_17533

    This resource has 10+ mentions.

http://www.addgene.org/17533

Genetic Insert: Puromycine Acetyl Transferase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:0; Vector Backbone:pCoHYGRO; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14513552

Proper citation: RRID:Addgene_17533 Copy   

    • RRID:Addgene_175283

    This resource has 1+ mentions.

http://www.addgene.org/175283

Species: Caenorhabditis elegans
Genetic Insert: DAF-16a
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:6000; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24671950

Proper citation: RRID:Addgene_175283 Copy   

    • RRID:Addgene_175284

http://www.addgene.org/175284

Species: Caenorhabditis elegans
Genetic Insert: daf-16a mini-gene
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pSL1180; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24671950

Proper citation: RRID:Addgene_175284 Copy   

http://www.addgene.org/175317

Species: Homo sapiens
Genetic Insert: IGF2BP1
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.

Proper citation: RRID:Addgene_175317 Copy   

    • RRID:Addgene_175318

http://www.addgene.org/175318

Species: Homo sapiens
Genetic Insert: IGF2BP2
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.

Proper citation: RRID:Addgene_175318 Copy   

http://www.addgene.org/175319

Species: Homo sapiens
Genetic Insert: IGF2BP3
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.

Proper citation: RRID:Addgene_175319 Copy   

    • RRID:Addgene_175274

    This resource has 1+ mentions.

http://www.addgene.org/175274

Species: Synthetic
Genetic Insert: Reverse tetracycline-controlled transactivator (rtTA)
Vector Backbone Description: Backbone Size:3951; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475

Proper citation: RRID:Addgene_175274 Copy   

    • RRID:Addgene_175275

    This resource has 1+ mentions.

http://www.addgene.org/175275

Species: Other
Genetic Insert: EGFP-Synaptobrevin-2; tdTomato
Vector Backbone Description: Backbone Size:4561; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Comments: Sequencing may be difficult due to secondary structure/dimerization. The following primers have been used in the Xu lab: 5': actcagcgctgcctcagtc (upstream of tdTomato) 3': ggccatgttgttgtcctcggaggaggcggtgc (in tdTomato) 5': gggcatggcaccggcagcaccggcagcggcagc (in tdTomato) 3': gctgaacttgtggccgtttacgtcg (in EGFP) 3': cagggtcagcttgccgtaggtggcatcg (in EGFP)

Proper citation: RRID:Addgene_175275 Copy   

    • RRID:Addgene_175276

    This resource has 1+ mentions.

http://www.addgene.org/175276

Species: Yellow fever virus strain 17D
Genetic Insert: Nonstructural protein 1 (NS1) of YFV-17D; NLS-dTomato
Vector Backbone Description: Backbone Size:4591; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475

Proper citation: RRID:Addgene_175276 Copy   

    • RRID:Addgene_175311

http://www.addgene.org/175311

Species: Mus musculus
Genetic Insert: HUR
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.

Proper citation: RRID:Addgene_175311 Copy   

    • RRID:Addgene_175279

    This resource has 1+ mentions.

http://www.addgene.org/175279

Species: Yellow fever virus strain 17D
Genetic Insert: NS1
Vector Backbone Description: Backbone Size:3901; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475

Proper citation: RRID:Addgene_175279 Copy   

    • RRID:Addgene_175313

http://www.addgene.org/175313

Species: Gallus gallus
Genetic Insert: HUR
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.

Proper citation: RRID:Addgene_175313 Copy   

    • RRID:Addgene_175314

http://www.addgene.org/175314

Species: X. tropicalis (frog)
Genetic Insert: HUR
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.

Proper citation: RRID:Addgene_175314 Copy   

    • RRID:Addgene_175271

    This resource has 1+ mentions.

http://www.addgene.org/175271

Vector Backbone Description: Vector Backbone:PiggyBac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35474898
Comments: Selectable marker is flanked by Rox sites for excision with Dre recombinase.

Proper citation: RRID:Addgene_175271 Copy   

    • RRID:Addgene_175273

    This resource has 1+ mentions.

http://www.addgene.org/175273

Species: Yellow fever virus strain 17D
Genetic Insert: Nonstructural protein 1 (NS1) of YFV-17D
Vector Backbone Description: Backbone Size:4470; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475

Proper citation: RRID:Addgene_175273 Copy   

    • RRID:Addgene_175340

http://www.addgene.org/175340

Species: Homo sapiens
Genetic Insert: NASP
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.

Proper citation: RRID:Addgene_175340 Copy   

    • RRID:Addgene_175339

http://www.addgene.org/175339

Species: Homo sapiens
Genetic Insert: RAN
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.

Proper citation: RRID:Addgene_175339 Copy   

http://www.addgene.org/175297

Vector Backbone Description: Vector Backbone:pH6HTC; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.

Proper citation: RRID:Addgene_175297 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch