Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: CCDC86
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.
Proper citation: RRID:Addgene_175323 Copy
Species: Homo sapiens
Genetic Insert: HSPA8
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.
Proper citation: RRID:Addgene_175325 Copy
Genetic Insert: Puromycine Acetyl Transferase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:0; Vector Backbone:pCoHYGRO; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14513552
Proper citation: RRID:Addgene_17533 Copy
Species: Caenorhabditis elegans
Genetic Insert: DAF-16a
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:6000; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24671950
Proper citation: RRID:Addgene_175283 Copy
Species: Caenorhabditis elegans
Genetic Insert: daf-16a mini-gene
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pSL1180; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24671950
Proper citation: RRID:Addgene_175284 Copy
Species: Homo sapiens
Genetic Insert: IGF2BP1
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.
Proper citation: RRID:Addgene_175317 Copy
Species: Homo sapiens
Genetic Insert: IGF2BP2
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.
Proper citation: RRID:Addgene_175318 Copy
Species: Homo sapiens
Genetic Insert: IGF2BP3
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.
Proper citation: RRID:Addgene_175319 Copy
Species: Synthetic
Genetic Insert: Reverse tetracycline-controlled transactivator (rtTA)
Vector Backbone Description: Backbone Size:3951; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Proper citation: RRID:Addgene_175274 Copy
Species: Other
Genetic Insert: EGFP-Synaptobrevin-2; tdTomato
Vector Backbone Description: Backbone Size:4561; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Comments: Sequencing may be difficult due to secondary structure/dimerization. The following primers have been used in the Xu lab:
5': actcagcgctgcctcagtc (upstream of tdTomato)
3': ggccatgttgttgtcctcggaggaggcggtgc (in tdTomato)
5': gggcatggcaccggcagcaccggcagcggcagc (in tdTomato)
3': gctgaacttgtggccgtttacgtcg (in EGFP)
3': cagggtcagcttgccgtaggtggcatcg (in EGFP)
Proper citation: RRID:Addgene_175275 Copy
Species: Yellow fever virus strain 17D
Genetic Insert: Nonstructural protein 1 (NS1) of YFV-17D; NLS-dTomato
Vector Backbone Description: Backbone Size:4591; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Proper citation: RRID:Addgene_175276 Copy
Species: Mus musculus
Genetic Insert: HUR
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.
Proper citation: RRID:Addgene_175311 Copy
Species: Yellow fever virus strain 17D
Genetic Insert: NS1
Vector Backbone Description: Backbone Size:3901; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Proper citation: RRID:Addgene_175279 Copy
Species: Gallus gallus
Genetic Insert: HUR
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.
Proper citation: RRID:Addgene_175313 Copy
Species: X. tropicalis (frog)
Genetic Insert: HUR
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.
Proper citation: RRID:Addgene_175314 Copy
Vector Backbone Description: Vector Backbone:PiggyBac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35474898
Comments: Selectable marker is flanked by Rox sites for excision with Dre recombinase.
Proper citation: RRID:Addgene_175271 Copy
Species: Yellow fever virus strain 17D
Genetic Insert: Nonstructural protein 1 (NS1) of YFV-17D
Vector Backbone Description: Backbone Size:4470; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Proper citation: RRID:Addgene_175273 Copy
Species: Homo sapiens
Genetic Insert: NASP
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.
Proper citation: RRID:Addgene_175340 Copy
Species: Homo sapiens
Genetic Insert: RAN
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.
Proper citation: RRID:Addgene_175339 Copy
Vector Backbone Description: Vector Backbone:pH6HTC; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.
Proper citation: RRID:Addgene_175297 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.