Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: ACE2
Vector Backbone Description: Vector Backbone:pLEX307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: The authors have noticed that recombination within the pLEX307 backbone can occur. All users are advised to sequence the vectors and restriction digest them and run them on a gel to ensure they show the expected full length insert and plasmid size. In cases where recombination has occurred, it is typically between the viral LTR elements in the vector, although recombination between the gateway cloning sites has also been observed.
Proper citation: RRID:Addgene_158449 Copy
Species: Homo sapiens
Genetic Insert: TMPRSS11D
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: The authors have noticed that recombination within the pLEX307 backbone can occur. All users are advised to sequence the vectors and restriction digest them and run them on a gel to ensure they show the expected full length insert and plasmid size. In cases where recombination has occurred, it is typically between the viral LTR elements in the vector, although recombination between the gateway cloning sites has also been observed.
Proper citation: RRID:Addgene_158447 Copy
Species: Homo sapiens
Genetic Insert: TMPRSS2
Vector Backbone Description: Vector Backbone:pLEX307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: The authors have noticed that recombination within the pLEX307 backbone can occur. All users are advised to sequence the vectors and restriction digest them and run them on a gel to ensure they show the expected full length insert and plasmid size. In cases where recombination has occurred, it is typically between the viral LTR elements in the vector, although recombination between the gateway cloning sites has also been observed.
Proper citation: RRID:Addgene_158457 Copy
Vector Backbone Description: Backbone Marker:EZbiolab; Backbone Size:2710; Vector Backbone:pUC57; Vector Types:Bacterial vector for DNA production; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22453276
Comments: Please cite the following article in any publications where this construct is utilized:
E.Y.D. Chua, D. Vasudevan, G.E. Davey, B. Wu & C.A. Davey. 2012. The Mechanics Behind DNA Sequence-Dependent Properties of the Nucleosome. Nucleic Acids Res. 40(13): 6338-6352.
Proper citation: RRID:Addgene_158572 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Backbone Marker:Addgene #83274; Vector Backbone:pEN_TTmiR2c_3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33740397
Comments: The plasmid differs from the MAVS reference sequence at 3 positions: Q93E, Q198K, and S409F.
Proper citation: RRID:Addgene_158628 Copy
Vector Backbone Description: Vector Backbone:pXPR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33606977
Comments: For questions regarding use of this plasmid, please contact John Doench.
Please visit https://www.biorxiv.org/content/10.1101/2020.05.17.100818v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_158581 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Backbone Marker:Addgene #25737; Vector Backbone:pSLIK hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33740397
Comments: The plasmid differs from the MAVS reference sequence at 3 position (Q93E, Q198K, and S409F). This plasmid has an additional Q148A and Q271A mutation. For pSLIK vectors, it is recommended to use zeocin in addition to ampicillin for bacterial selection.
Proper citation: RRID:Addgene_158639 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Backbone Marker:Addgene #25737; Vector Backbone:pSLIK hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33740397
Comments: The plasmid differs from the MAVS reference sequence at 2 positions (Q198K and S409F). For pSLIK vectors, it is recommended to use zeocin in addition to ampicillin for bacterial selection.
Proper citation: RRID:Addgene_158635 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Backbone Marker:Addgene #25737; Vector Backbone:pSLIK hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33740397
Comments: The plasmid differs from the MAVS reference sequence at 3 positions: Q93E, Q198K, and S409F. This plasmid has an additional Q148A mutation. For pSLIK vectors, it is recommended to use zeocin in addition to ampicillin for bacterial selection.
Proper citation: RRID:Addgene_158636 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Backbone Marker:Addgene #83274; Vector Backbone:pEN_TTmiR2c_3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33740397
Comments: The plasmid differs from the MAVS reference sequence at 3 position (Q93E, Q198K, and S409F). This plasmid has an additional Q148A and Q271A mutation. Gene point mutations were performed using the QuikChange Kit (Agilent Cat#200517) two times on the pEN_TT 3XFLAG-MAVS plasmid: one mutagenesis to yield pEN_TT 3XFLAG-MAVS-Q148A and a second mutagenesis to yield the double mutant.
Proper citation: RRID:Addgene_158633 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Backbone Marker:Addgene #83274; Vector Backbone:pEN_TTmiR2c_3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33740397
Comments: The plasmid differs from the MAVS reference sequence at 2 positions (Q198K and S409F). This plamid has an additional Q271A mutation, and amino acid 93 (glutamate, E) was mutated back to the reference (glutamine, Q). Gene point mutations were performed using the QuikChange Kit (Agilent Cat#200517) two times on the pEN_TT 3XFLAG-MAVS plasmid: one mutagenesis to yield pEN_TT 3XFLAG-MAVS-Q271A and a second mutagenesis to yield the double mutant. The clones displayed consistent off-target mutations at one of two points. Two clones with different off-target mutations were digested and the good pieces ligated together so to yield the final sequence.
Proper citation: RRID:Addgene_158632 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Backbone Marker:Addgene #83274; Vector Backbone:pEN_TTmiR2c_3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33740397
Comments: The plasmid differs from the MAVS reference sequence at 3 positions: Q93E, Q198K, and S409F. This plasmid has an additional Q148A mutation. Gene point mutations were performed using the QuikChange Kit (Agilent Cat#200517) on the pEN_TT 3XFLAG-MAVS plasmid.
Proper citation: RRID:Addgene_158630 Copy
Species: Francisella tularensis subsp. novicida
Genetic Insert: sacA crRNA
Vector Backbone Description: Backbone Size:5952; Vector Backbone:pAD123; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology, Shuttle vector Bacillus subtilis / E. coli; Bacterial Resistance:Ampicillin
Comments: Please note: Plasmid contains an E295G mutation in rep60. This mutation is not expected to affect plasmid function.
Proper citation: RRID:Addgene_158649 Copy
Species: Simian virus 40
Genetic Insert: SV40Tag
Vector Backbone Description: Backbone Marker:Addgene #13425; Vector Backbone:pLKO.1 neo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33740397
Proper citation: RRID:Addgene_158646 Copy
Species: Francisella tularensis subsp. novicida
Genetic Insert: Cpf1, ganA crRNA
Vector Backbone Description: Backbone Size:7956; Vector Backbone:pHT01; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology, Shuttle vector Bacillus subtilis / E. coli; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_158647 Copy
Species: Other
Genetic Insert: CVB3
Vector Backbone Description: Backbone Marker:Invitrogen/Addgene #2092; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: There is an internal EcoRI site in the CVB3 sequence.
Proper citation: RRID:Addgene_158645 Copy
Species: Homo sapiens
Genetic Insert: OAS2
Vector Backbone Description: Backbone Marker:Addgene #25896; Vector Backbone:pLX302; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33740397
Proper citation: RRID:Addgene_158642 Copy
Species: Homo sapiens
Genetic Insert: Mx1
Vector Backbone Description: Backbone Marker:Addgene #25896; Vector Backbone:pLX302; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33740397
Comments: Addgene NGS identified F660S variant in MX1 ORF, depositing lab confirmed this variant present in the original version of plasmid used in associated publication.
Proper citation: RRID:Addgene_158640 Copy
Species: Francisella tularensis subsp. novicida
Genetic Insert: sacA crRNA
Vector Backbone Description: Backbone Size:6499; Vector Backbone:pBSG03; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology, Shuttle vector Bacillus subtilis / E. coli; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_158650 Copy
Species: Homo sapiens
Genetic Insert: PP2A regulatory subunit A, beta isoform
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176
Comments: Target sequence: CAACAATTGCCCTAGCACTTG
Proper citation: RRID:Addgene_15250 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
