Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
EF1a-iRFP670-SV40_pKG726 Resource Report Resource Website |
RRID:Addgene_246374 | iRFP670 | Other | Kanamycin | PMID:41083901 | Please visit https://doi.org/10.1101/2024.06.19.599813 for bioRxiv preprint. | Vector Backbone:pENTR4; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | none | 2026-08-15 01:34:31 | 0 |
|
pX461-ABE8e-nSpCas9-NRF1-ss-sgRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_237466 | gRNA targeting NRF1-Ex7 splice site | Other | Ampicillin | PMID:41633991 | Backbone Marker:Feng Zhang (Addgene plasmid # 62988); Vector Backbone:pX459v2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:34:47 | 1 | ||
|
pX461-evoCDA1-nSpCas9-Intergenic sgRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_237464 | Intergenic sgRNA | Other | Ampicillin | PMID:41633991 | Backbone Marker:Feng Zhang (Addgene plasmid # 62988); Vector Backbone:pX459v2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:34:46 | 1 | ||
|
pX462-ABE8e-nSaCas9-Intergenic sgRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_237465 | Intergenic sgRNA | Other | Ampicillin | PMID:41633991 | Backbone Marker:Feng Zhang (Addgene plasmid # 62988); Vector Backbone:pX459v2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:34:46 | 1 | ||
|
pX462-ABE8e-nSaCas9-NRF1-ss-sgRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_237468 | gRNA targeting NRF1-Ex7 splice site | Other | Ampicillin | PMID:41633991 | Backbone Marker:Feng Zhang (Addgene plasmid # 62988); Vector Backbone:pX459v2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:34:46 | 1 | ||
|
pIVT-ABE-DEN2 Resource Report Resource Website |
RRID:Addgene_238020 | TadA8e-nSpCas9(D10A) | Other | Ampicillin | PMID:39928528 | Backbone Marker:Caixia Gao, Addgene Plasmid #98164; Vector Backbone:pnCas9-PBE; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin | D10A for SpCas9 | 2026-08-15 01:34:14 | 0 | |
|
pENTR-SlmiR482bTS-B/c Resource Report Resource Website 1+ mentions |
RRID:Addgene_234368 | B/c | Other | Chloramphenicol and Kanamycin | PMID:41085227 | Backbone Size:2617; Vector Backbone:pENTR; Vector Types:; Bacterial Resistance:Chloramphenicol and Kanamycin | 2026-08-15 01:34:14 | 1 | ||
|
pMDC32B-SlmiR482bTS-B/c Resource Report Resource Website 1+ mentions |
RRID:Addgene_234369 | B/c | Other | Chloramphenicol and Kanamycin | PMID:41085227 | Vector Backbone:pMDC32; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Kanamycin | 2026-08-15 01:34:14 | 1 | ||
|
pDestTol2CR-QUAS:mNeonGreen-NES-P2A-mKate2-NLS Resource Report Resource Website |
RRID:Addgene_241912 | QUAS enhancer driving mNeonGreen-NES and mKate2-NLS | Other | Ampicillin | PMID:41123438 | Backbone Size:7839; Vector Backbone:pDestTol2CR; Vector Types:zebrafish Tol2 transgenesis; Bacterial Resistance:Ampicillin | 2026-08-15 01:34:15 | 0 | ||
|
pRsetB-CitA-Tq-LR Resource Report Resource Website |
RRID:Addgene_241830 | CitA-Tq-LR | Other | Kanamycin | PMID:41071660 | Vector Backbone:pRsetB; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:34:14 | 0 | ||
|
pAAV-P3-Alb-mStayGold Resource Report Resource Website 1+ mentions |
RRID:Addgene_234549 | Alb-mStayGold | Other | Ampicillin | PMID:41393514 | Backbone Marker:VVF (p438) https://vvf.ethz.ch/ ; Vector Backbone:pAAV-P3 (Addgene plasmid #183460); Vector Types:AAV; Bacterial Resistance:Ampicillin | None | 2026-08-15 01:34:16 | 1 | |
|
pET28a(+)v2_TwinStrep-SUMO-φC31(PhiC31)-8xHis Resource Report Resource Website |
RRID:Addgene_246982 | φC31(PhiC31) | Other | Kanamycin | We use a tag-free SUMO protease (ulp1) for cleaving the TwinStrep tag from the final product. Tag-free ulp1 can be synthesized using Addgene Plasmid #190063 and a His-tagged TEV protease or HRV-3C protease (PreScission protease). The total insert size displayed on this page (2403bp) includes all tags and linkers. | Backbone Marker:NA; Backbone Size:5218; Vector Backbone:pET28a(+)v2; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:34:16 | 0 | ||
|
LLP1018 Resource Report Resource Website |
RRID:Addgene_239940 | CaMV 35S::dCas9 | Other | Spectinomycin | PMID:38769424 | Vector Backbone:Binary; Vector Types:Plant Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Spectinomycin | N/A | 2026-08-15 01:34:17 | 0 | |
|
LLP1024 Resource Report Resource Website |
RRID:Addgene_239946 | CaMV 35S-SynPro-01::Rluc | Other | Ampicillin | PMID:38769424 | Vector Backbone:pBluescript SK(+); Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:34:17 | 0 | |
|
SB39 Resource Report Resource Website |
RRID:Addgene_235121 | Other | None | PMID:42199375 | Genotype: E. coli B F- ompT gal dcm lon hsdSB(rB–mB–) λ(DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB+]K-12(λS) ΔendA ΔrecA glvC ::[ phlFAM, cymRAM, luxR, vanRAM, lacIAM, tetR ] Fast growth at 37C in LB (doubling time ~ 20-25 minutes) and improved DNA (endA, recA) and protein stability (lon, ompT). Strain validation: - PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 5 518 bp. - PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1160(GCTTGTCGACGACGGC) generates a product of 140 bp. - PCR using OR1157 (TACCCCAGTTGGGGCAC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 110 bp. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:34:17 | 0 | ||
|
LLP1015 Resource Report Resource Website |
RRID:Addgene_239937 | CaMV 35S::dCas9 | Other | Ampicillin | PMID:38769424 | Vector Backbone:pBluescript SK(+); Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:34:17 | 0 | |
|
LLP965 Resource Report Resource Website |
RRID:Addgene_239887 | CaMV 35S::Rluc | Other | Ampicillin | PMID:38769424 | Vector Backbone:pBluescript SK(+); Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:34:17 | 0 | |
|
LLP1014 Resource Report Resource Website |
RRID:Addgene_239936 | Hsp18.2::sgRNA-B | Other | Kanamycin | PMID:38769424 | Please note: This plasmid contains an IS4 transposable element inserted in the backbone. This insertion does not impact plasmid function. | Vector Backbone:pCK2; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | N/A | 2026-08-15 01:34:20 | 0 |
|
CMV-mCherry Resource Report Resource Website |
RRID:Addgene_241313 | mCherry fluorescent protein | Other | Kanamycin | Vector Backbone:pMAX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:34:20 | 0 | |||
|
lenti_Pemax_t2a_GFP-Kash Resource Report Resource Website |
RRID:Addgene_238541 | Pemax-T2A-GFP | Other | Ampicillin | PMID:40705858 | Vector Backbone:n.a.; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:35:00 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
