Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
MSCV-6NBC-GFP-PGK-Puro-Barcode96 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83773 | Barcode96 | Synthetic | Ampicillin | PMID:27617390 | Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:11 | 1 | ||
|
MSCV-6NBC-GFP-PGK-Puro-Barcode93 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83770 | Barcode93 | Synthetic | Ampicillin | PMID:27617390 | Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:11 | 1 | ||
|
MSCV-6NBC-GFP-PGK-Puro-Barcode95 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83772 | Barcode95 | Synthetic | Ampicillin | PMID:27617390 | Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:08 | 1 | ||
|
MSCV-6NBC-GFP-PGK-Puro-Barcode72 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83749 | Barcode72 | Synthetic | Ampicillin | PMID:27617390 | Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:07 | 1 | ||
|
Clover-Geminin(1-110) Resource Report Resource Website 1+ mentions |
RRID:Addgene_83915 | Clover-Geminin(1-110) | Synthetic | Ampicillin | PMID:27798610 | Backbone Size:6500; Vector Backbone:pLL3.7m; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:13 | 6 | ||
|
pAAV-hDlx-Flex-GFP-Fishell_6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83895 | eGFP | Synthetic | Ampicillin | PMID:27798629 | Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:09 | 5 | ||
|
pKS1 Resource Report Resource Website |
RRID:Addgene_84079 | Tetanus neurotoxin fragment C | Synthetic | Kanamycin | PMID:10972823 | Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:21:14 | 0 | ||
|
pMTB-Multibow-hY Resource Report Resource Website |
RRID:Addgene_60995 | citrine | Synthetic | Ampicillin | PMID:26010570 | Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region. | Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 0 | |
|
pMTB-Multibow-hG Resource Report Resource Website |
RRID:Addgene_60994 | EGFP | Synthetic | Ampicillin | PMID:26010570 | Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region. | Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 0 | |
|
pMTB-Multibow-hO Resource Report Resource Website |
RRID:Addgene_60996 | mKO | Synthetic | Ampicillin | PMID:26010570 | Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region. | Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 0 | |
|
AAV-hSyn-REX-GECO1 Resource Report Resource Website |
RRID:Addgene_61248 | REX-GECO1 | Synthetic | Ampicillin | PMID:25358432 | The construct is numbered based on GCaMP. There are 2 mismatches between Addgene's sequence and the provided reference sequence. These should not affect plasmid function. | Backbone Size:4560; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | Substitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, S142P, D147V, E148G, P220L, N257I, A302P, M339L, T382S | 2026-08-15 01:17:40 | 0 |
|
CMV-REX-GECO0.9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61247 | REX-GECO0.9 | Synthetic | Ampicillin | PMID:25358432 | The construct is numbered based on GCaMP. | Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Substitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, E138V, S142P, D147V, P220L, N257I, N267D, A302P, M339L, T382S | 2026-08-15 01:17:40 | 1 |
|
AAV-hSyn-REX-GECO0.9 Resource Report Resource Website |
RRID:Addgene_61249 | REX-GECO0.9 | Synthetic | Ampicillin | PMID:25358432 | The construct is numbered based on GCaMP. There are 2 mismatches between Addgene's sequence and the provided reference sequence. These should not affect plasmid function. | Backbone Size:4560; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | Substitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, E138V, S142P, D147V, P220L, N257I, N267D, A302P, M339L, T382S | 2026-08-15 01:17:40 | 0 |
|
pJW1219 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61250 | sgRNA(F+E) | Synthetic | Ampicillin | PMID:25491644 | target sequence: ggatggatgtgtagtcaatt | Backbone Marker:Goldstein lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:40 | 5 | |
|
pCaSpeR-act5cB-GAL4QF Resource Report Resource Website |
RRID:Addgene_61309 | GAL4_DBD::QF2w_AD | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Changed EK on C-terminus of QF2 to KKKK | 2026-08-15 01:17:40 | 0 |
|
pQF2wWB Resource Report Resource Website 1+ mentions |
RRID:Addgene_61313 | QF2w | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Vector Backbone:pGAWB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:40 | 2 | |
|
pCaSpeR-act5cB-LexAQFw Resource Report Resource Website |
RRID:Addgene_61311 | LexA_DBD::QF2w_AD | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Changed EK on C-terminus of QF2 to KKKK | 2026-08-15 01:17:41 | 0 |
|
pCaSpeR-act5cB-LexAQF Resource Report Resource Website |
RRID:Addgene_61310 | LexA_DBD::QF2_AD | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:40 | 0 | |
|
lenti dCAS-VP64_Blast Resource Report Resource Website 100+ mentions |
RRID:Addgene_61425 | dCAS9(D10A, N863A)-VP64_2A_Blast | Synthetic | Ampicillin | PMID:25494202 | IMPORTANT NOTE: If you intend to order the SAM library, this plasmid will come included with that order. Please do NOT order this plasmid if you are already planning to order the SAM library. For additional information, protocols and an activator sgRNA design tool, visit our website: http://sam.genome-engineering.org/ | Vector Backbone:plenti; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | D10A and N863A in Cas9 | 2026-08-15 01:17:42 | 234 |
|
pCS2-Cer.zf1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61389 | Cer.zf1 | Synthetic | Ampicillin | PMID:25628360 | Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:41 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
