Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 317 showing 6321 ~ 6340 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_152437

    This resource has 1+ mentions.

http://www.addgene.org/152437

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp8
Vector Backbone Description: Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725304.1

Proper citation: RRID:Addgene_152437 Copy   


  • RRID:Addgene_15249

    This resource has 1+ mentions.

http://www.addgene.org/15249

Species: Homo sapiens
Genetic Insert: PP2A regulatory subunit A, alpha isoform
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176
Comments: Target sequence: GACAACAGCACCTTGCAGAGT

Proper citation: RRID:Addgene_15249 Copy   


http://www.addgene.org/15264

Species: Homo sapiens
Genetic Insert: IKB alpha
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17574021

Proper citation: RRID:Addgene_15264 Copy   


  • RRID:Addgene_152594

    This resource has 1+ mentions.

http://www.addgene.org/152594

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 N (nucleocapsid)
Vector Backbone Description: Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724397.2

Proper citation: RRID:Addgene_152594 Copy   


  • RRID:Addgene_15269

    This resource has 10+ mentions.

http://www.addgene.org/15269

Species: Homo sapiens
Genetic Insert: BRAF
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17574021

Proper citation: RRID:Addgene_15269 Copy   


  • RRID:Addgene_15290

    This resource has 1+ mentions.

http://www.addgene.org/15290

Species: Homo sapiens
Genetic Insert: inhibitor of Kappa B alpha
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17574021

Proper citation: RRID:Addgene_15290 Copy   


  • RRID:Addgene_153055

    This resource has 1+ mentions.

http://www.addgene.org/153055

Species: Homo sapiens
Genetic Insert: RARS
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium; Vector Backbone:pNIC-Bio3; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Backbone vector pNIC-Bio3, Genbank acc. no. JN792439

Proper citation: RRID:Addgene_153055 Copy   


http://www.addgene.org/153061

Species: Homo sapiens
Genetic Insert: BHLHE40
Vector Backbone Description: Backbone Size:8871; Vector Backbone:pLVX-EF1α-IRES-ZsGreen1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32205878

Proper citation: RRID:Addgene_153061 Copy   


  • RRID:Addgene_15305

    This resource has 1+ mentions.

http://www.addgene.org/15305

Genetic Insert: VP16AD-ZIP+
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pActPL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17088209
Comments: The heterodimerizing leucine zipper is based on the chicken B-Zip family member Vitellogenin Binding Protein. The EE12RR345L (Zip+) domain was generated from synthetic oligonucleotides with codon usage optimized for Drosophila expression.

Proper citation: RRID:Addgene_15305 Copy   


  • RRID:Addgene_15303

    This resource has 1+ mentions.

http://www.addgene.org/15303

Genetic Insert: Gal4AD-ZIP+
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pActPL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17088209
Comments: The heterodimerizing leucine zipper is based on the chicken B-Zip family member Vitellogenin Binding Protein. The EE12RR345L (Zip+) domain was generated from synthetic oligonucleotides with codon usage optimized for Drosophila expression.

Proper citation: RRID:Addgene_15303 Copy   


http://www.addgene.org/153007

Genetic Insert: sTurboID (C) (G74)-ERM (Cb5)
Vector Backbone Description: Backbone Size:8233; Vector Backbone:pLX208; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32424107

Proper citation: RRID:Addgene_153007 Copy   


http://www.addgene.org/153002

Genetic Insert: sTurboID (N) (L73)
Vector Backbone Description: Backbone Size:7668; Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32424107

Proper citation: RRID:Addgene_153002 Copy   


  • RRID:Addgene_15312

    This resource has 1+ mentions.

http://www.addgene.org/15312

Species: Drosophila melanogaster
Genetic Insert: Actin5c
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pMT-V5/His'B'; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12975351

Proper citation: RRID:Addgene_15312 Copy   


http://www.addgene.org/153175

Species: SARS-CoV-2 isolate Wuhan-Hu-1
Genetic Insert: S-frag3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32763951

Proper citation: RRID:Addgene_153175 Copy   


  • RRID:Addgene_153109

    This resource has 1+ mentions.

http://www.addgene.org/153109

Species: Homo sapiens
Genetic Insert: human FOXA1
Vector Backbone Description: Backbone Size:4131; Vector Backbone:pCS2+ N-flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32858261

Proper citation: RRID:Addgene_153109 Copy   


  • RRID:Addgene_153106

    This resource has 1+ mentions.

http://www.addgene.org/153106

Species: Saccharomyces cerevisiae
Genetic Insert: gRNA library targeting yeast transporters
Vector Backbone Description: Backbone Marker:Jean-Marc Daran; Vector Backbone:Addgene #107916: pMEL10; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33465478

Proper citation: RRID:Addgene_153106 Copy   


  • RRID:Addgene_15308

    This resource has 1+ mentions.

http://www.addgene.org/15308

Genetic Insert: VP16AD-ZIP+
Vector Backbone Description: Backbone Size:13475; Vector Backbone:pCaST-elav; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17088209
Comments: The heterodimerizing leucine zipper is based on the chicken B-Zip family member Vitellogenin Binding Protein. The EE12RR345L (Zip+) domain was generated from synthetic oligonucleotides with codon usage optimized for Drosophila expression.

Proper citation: RRID:Addgene_15308 Copy   


  • RRID:Addgene_153128

    This resource has 1+ mentions.

http://www.addgene.org/153128

Species: Homo sapiens
Genetic Insert: human FOXI3
Vector Backbone Description: Backbone Size:4131; Vector Backbone:pCS2+ N-flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32858261

Proper citation: RRID:Addgene_153128 Copy   


  • RRID:Addgene_153122

    This resource has 1+ mentions.

http://www.addgene.org/153122

Species: Homo sapiens
Genetic Insert: human FOXF1
Vector Backbone Description: Backbone Size:4131; Vector Backbone:pCS2+ N-flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32858261

Proper citation: RRID:Addgene_153122 Copy   


  • RRID:Addgene_153136

    This resource has 1+ mentions.

http://www.addgene.org/153136

Species: Homo sapiens
Genetic Insert: human FOXM1
Vector Backbone Description: Backbone Size:4131; Vector Backbone:pCS2+ N-flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32858261

Proper citation: RRID:Addgene_153136 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X