Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 317 showing 6321 ~ 6340 out of 328,858 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/163480

Species: Synthetic
Genetic Insert: tTA2
Vector Backbone Description: Backbone Marker:Allen Institute; Vector Backbone:pAAV-mscRE4-minBGprom-IRES2-tTA2-hGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33789083
Comments: Funded by BRAIN initiative.

Proper citation: RRID:Addgene_163480 Copy   


http://www.addgene.org/163474

Species: Synthetic
Genetic Insert: FlpO
Vector Backbone Description: Backbone Marker:Allen Institute; Vector Backbone:pAAV-mscRE4-minBGpromoter-FlpO-WPRE-hGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33789083
Comments: Funded by BRAIN initiative.

Proper citation: RRID:Addgene_163474 Copy   


http://www.addgene.org/163473

Species: Synthetic
Genetic Insert: FlpO
Vector Backbone Description: Backbone Marker:Allen Institute; Vector Backbone:pAAV-mscRE4-minBGpromoter-FlpO-WPRE-hGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33789083
Comments: Funded by BRAIN initiative.

Proper citation: RRID:Addgene_163473 Copy   


http://www.addgene.org/163476

Species: Synthetic
Genetic Insert: iCre
Vector Backbone Description: Backbone Marker:Allen Institute; Vector Backbone:pAAV-mscRE4-minBGprom-IRES2-FlpO-WPRE-hGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33789083
Comments: Funded by BRAIN initiative.

Proper citation: RRID:Addgene_163476 Copy   


http://www.addgene.org/163475

Species: Synthetic
Genetic Insert: FlpO
Vector Backbone Description: Backbone Marker:Allen Institute; Vector Backbone:pAAV-mscRE4-minBGpromoter-FlpO-WPRE-hGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33789083
Comments: Funded by BRAIN initiative.

Proper citation: RRID:Addgene_163475 Copy   


http://www.addgene.org/163477

Species: Synthetic
Genetic Insert: iCre
Vector Backbone Description: Backbone Marker:Allen Institute; Vector Backbone:pAAV-mscRE4-minBGpromoter-iCre-WPRE-hGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33789083
Comments: Funded by BRAIN initiative.

Proper citation: RRID:Addgene_163477 Copy   


http://www.addgene.org/163479

Species: Synthetic
Genetic Insert: iCre
Vector Backbone Description: Backbone Marker:Allen Institute; Vector Backbone:pAAV-mscRE4-minBGpromoter-iCre-WPRE-hGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33789083
Comments: Funded by BRAIN initiative.

Proper citation: RRID:Addgene_163479 Copy   


  • RRID:Addgene_1636

http://www.addgene.org/1636

Vector Backbone Description: Backbone Size:6850; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1999. Fire Lab Miniprep Number pPD122.64, Ligation number L4062.

Proper citation: RRID:Addgene_1636 Copy   


  • RRID:Addgene_163609

http://www.addgene.org/163609

Species: Aequorea victoria
Genetic Insert: Egfp
Vector Backbone Description: Vector Backbone:pCAFNF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760

Proper citation: RRID:Addgene_163609 Copy   


  • RRID:Addgene_163608

http://www.addgene.org/163608

Species: Synthetic
Genetic Insert: LifeAct
Vector Backbone Description: Vector Backbone:pCAFNF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760

Proper citation: RRID:Addgene_163608 Copy   


  • RRID:Addgene_163605

http://www.addgene.org/163605

Species: Mus musculus
Genetic Insert: Rhoa
Vector Backbone Description: Backbone Size:6061; Vector Backbone:pCAFNF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760

Proper citation: RRID:Addgene_163605 Copy   


  • RRID:Addgene_163606

http://www.addgene.org/163606

Species: Mus musculus
Genetic Insert: Cdc42
Vector Backbone Description: Vector Backbone:pCAFNF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760

Proper citation: RRID:Addgene_163606 Copy   


http://www.addgene.org/163550

Species: Homo sapiens
Genetic Insert: RBMX-eA3A-UdgX-HF-NG-nCas9
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34183861

Proper citation: RRID:Addgene_163550 Copy   


  • RRID:Addgene_163582

http://www.addgene.org/163582

Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Impaired Edc3 binding sites (first HLM, and 5 additional HLMs in C-terminal domain). 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG

Proper citation: RRID:Addgene_163582 Copy   


  • RRID:Addgene_163581

http://www.addgene.org/163581

Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: C-terminal domain (327-970) containing 5 impaired Edc3 binding sites (5 additional HLMs in C-terminal domain); N-terminal domain (1-299) including first HLM is removed. 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG

Proper citation: RRID:Addgene_163581 Copy   


  • RRID:Addgene_163585

http://www.addgene.org/163585

Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG

Proper citation: RRID:Addgene_163585 Copy   


  • RRID:Addgene_163580

http://www.addgene.org/163580

Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Impaired Edc3 binding site (first HLM); impaired RNA cap recognition site (W50, D54). 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG

Proper citation: RRID:Addgene_163580 Copy   


  • RRID:Addgene_163623

http://www.addgene.org/163623

Species: Mus musculus
Genetic Insert: mouse NL2
Vector Backbone Description: Vector Backbone:pGEX4T3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31775031

Proper citation: RRID:Addgene_163623 Copy   


  • RRID:Addgene_163625

    This resource has 1+ mentions.

http://www.addgene.org/163625

Species: Homo sapiens
Genetic Insert: DCLK1
Vector Backbone Description: Vector Backbone:pLenti6; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32755567
Comments: Please note that the Addgene NGS sequence differs from the depositor's annotated sequence. These differences do not affect plasmid function.

Proper citation: RRID:Addgene_163625 Copy   


  • RRID:Addgene_163626

    This resource has 1+ mentions.

http://www.addgene.org/163626

Species: Homo sapiens
Genetic Insert: DCLK1
Vector Backbone Description: Vector Backbone:pLenti6; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32755567
Comments: Please note that the Addgene NGS sequence differs from the depositor's annotated sequence. These differences do not affect plasmid function.

Proper citation: RRID:Addgene_163626 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X